Transcript: Mouse XM_006506132.3

PREDICTED: Mus musculus serine/threonine/tyrosine kinase 1 (Styk1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Styk1 (243659)
Length:
3502
CDS:
959..2248

Additional Resources:

NCBI RefSeq record:
XM_006506132.3
NBCI Gene record:
Styk1 (243659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506132.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362260 AGGTGTTAAGGTGAGTCAATA pLKO_005 2747 3UTR 100% 13.200 18.480 N Styk1 n/a
2 TRCN0000362253 TCCTAGACAAATGACTATATA pLKO_005 2255 3UTR 100% 15.000 10.500 N Styk1 n/a
3 TRCN0000362254 AGCAGTATGAAGTAATCATTG pLKO_005 1035 CDS 100% 10.800 7.560 N Styk1 n/a
4 TRCN0000023730 CCAGGAACATCCTGATCCAAA pLKO.1 1734 CDS 100% 4.950 3.465 N Styk1 n/a
5 TRCN0000023729 CGAGAGAAGCAGTATGAAGTA pLKO.1 1028 CDS 100% 4.950 3.465 N Styk1 n/a
6 TRCN0000023732 TGCTCTATGATCTCACAGAAA pLKO.1 1629 CDS 100% 4.950 3.465 N Styk1 n/a
7 TRCN0000023731 GCCTAGAAGCTGCTTCTAGAT pLKO.1 2115 CDS 100% 0.495 0.347 N Styk1 n/a
8 TRCN0000362330 TCCCACCAGCATCCTACAATA pLKO_005 1972 CDS 100% 13.200 7.920 N Styk1 n/a
9 TRCN0000023733 GTGCCTGAACTGTATGCAGAT pLKO.1 2177 CDS 100% 4.050 2.430 N Styk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506132.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.