Transcript: Mouse XM_006506152.3

PREDICTED: Mus musculus tetratricopeptide repeat domain 26 (Ttc26), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttc26 (264134)
Length:
4235
CDS:
118..1674

Additional Resources:

NCBI RefSeq record:
XM_006506152.3
NBCI Gene record:
Ttc26 (264134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201320 GCAATCACTTTCGCCTTTATA pLKO.1 797 CDS 100% 15.000 21.000 N Ttc26 n/a
2 TRCN0000192948 GACGACACTAACTTATGGATT pLKO.1 286 CDS 100% 4.950 6.930 N Ttc26 n/a
3 TRCN0000192807 GCTCGCTGCTATATTATGAAT pLKO.1 1420 CDS 100% 5.625 4.500 N Ttc26 n/a
4 TRCN0000215496 GCTAGTGAATGTGATACAATA pLKO.1 1174 CDS 100% 13.200 9.240 N Ttc26 n/a
5 TRCN0000419810 GCTAGTGAATGTGATACAATA pLKO_005 1174 CDS 100% 13.200 9.240 N TTC26 n/a
6 TRCN0000160788 CCTCTTGATCCAAAGTGAGAA pLKO.1 1365 CDS 100% 4.950 3.465 N TTC26 n/a
7 TRCN0000190598 GCTTCCTGAAAGACACTCATT pLKO.1 3769 3UTR 100% 4.950 3.465 N Ttc26 n/a
8 TRCN0000192659 GCTTGTTTGTATGCTCTGTAA pLKO.1 3114 3UTR 100% 4.950 3.465 N Ttc26 n/a
9 TRCN0000190864 GAGTATATCCTCAAGGGAGTT pLKO.1 1069 CDS 100% 4.050 2.835 N Ttc26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12654 pDONR223 100% 45.8% 48.2% None (many diffs) n/a
2 ccsbBroad304_12654 pLX_304 0% 45.8% 48.2% V5 (many diffs) n/a
3 TRCN0000467225 TTCGTTTTAAACCACGATTGTGAA pLX_317 39.8% 45.8% 48.2% V5 (many diffs) n/a
Download CSV