Transcript: Mouse XM_006506189.3

PREDICTED: Mus musculus cullin 1 (Cul1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cul1 (26965)
Length:
3016
CDS:
244..2574

Additional Resources:

NCBI RefSeq record:
XM_006506189.3
NBCI Gene record:
Cul1 (26965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012768 CCGCACTTAAATCAATACATT pLKO.1 2841 3UTR 100% 5.625 7.875 N Cul1 n/a
2 TRCN0000280219 CCGCACTTAAATCAATACATT pLKO_005 2841 3UTR 100% 5.625 7.875 N Cul1 n/a
3 TRCN0000012769 GCCGCATGTATAATCTTGTAT pLKO.1 1202 CDS 100% 5.625 7.875 N Cul1 n/a
4 TRCN0000280163 GCCGCATGTATAATCTTGTAT pLKO_005 1202 CDS 100% 5.625 7.875 N Cul1 n/a
5 TRCN0000012771 CCAATGTTGATGAGGTGGAAT pLKO.1 2210 CDS 100% 4.950 6.930 N Cul1 n/a
6 TRCN0000279915 CCAATGTTGATGAGGTGGAAT pLKO_005 2210 CDS 100% 4.950 6.930 N Cul1 n/a
7 TRCN0000012772 GCTTGGAGTTATACAAGCGAT pLKO.1 497 CDS 100% 0.264 0.370 N Cul1 n/a
8 TRCN0000012770 GCATTGATATTCTCATCGAAA pLKO.1 2498 CDS 100% 4.950 3.465 N Cul1 n/a
9 TRCN0000280164 GCATTGATATTCTCATCGAAA pLKO_005 2498 CDS 100% 4.950 3.465 N Cul1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11274 pDONR223 100% 52% 55.1% None (many diffs) n/a
2 ccsbBroad304_11274 pLX_304 0% 52% 55.1% V5 (many diffs) n/a
3 TRCN0000478962 CTCATCCCATCGAATTCGTTCCTG pLX_317 27.5% 52% 55.1% V5 (many diffs) n/a
Download CSV