Transcript: Mouse XM_006506216.3

PREDICTED: Mus musculus ubiquitin specific peptidase 39 (Usp39), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp39 (28035)
Length:
1787
CDS:
66..1787

Additional Resources:

NCBI RefSeq record:
XM_006506216.3
NBCI Gene record:
Usp39 (28035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030926 GCCCGTACTTGGATACCATTA pLKO.1 376 CDS 100% 10.800 15.120 N Usp39 n/a
2 TRCN0000308680 GCCCGTACTTGGATACCATTA pLKO_005 376 CDS 100% 10.800 15.120 N Usp39 n/a
3 TRCN0000030925 CCCGCTCTATAAGGATGAGAA pLKO.1 1256 CDS 100% 4.950 6.930 N Usp39 n/a
4 TRCN0000308615 CCCGCTCTATAAGGATGAGAA pLKO_005 1256 CDS 100% 4.950 6.930 N Usp39 n/a
5 TRCN0000030928 GCAAGAAGACTTTCCAAATTA pLKO.1 982 CDS 100% 15.000 10.500 N Usp39 n/a
6 TRCN0000308611 GCAAGAAGACTTTCCAAATTA pLKO_005 982 CDS 100% 15.000 10.500 N Usp39 n/a
7 TRCN0000030927 CCTGACAACTATGAAATCATT pLKO.1 588 CDS 100% 5.625 3.938 N Usp39 n/a
8 TRCN0000308681 CCTGACAACTATGAAATCATT pLKO_005 588 CDS 100% 5.625 3.938 N Usp39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02512 pDONR223 100% 86.8% 93.2% None (many diffs) n/a
2 ccsbBroad304_02512 pLX_304 0% 86.8% 93.2% V5 (many diffs) n/a
3 TRCN0000472272 TGTCTCGCAGCTACAGTGGCTTAG pLX_317 26.4% 86.8% 93.2% V5 (many diffs) n/a
Download CSV