Transcript: Mouse XM_006506464.1

PREDICTED: Mus musculus eukaryotic elongation factor, selenocysteine-tRNA-specific (Eefsec), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eefsec (65967)
Length:
1885
CDS:
431..1549

Additional Resources:

NCBI RefSeq record:
XM_006506464.1
NBCI Gene record:
Eefsec (65967)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000292899 CCAGACTAGATGCCGACATTC pLKO_005 1050 CDS 100% 10.800 15.120 N Eefsec n/a
2 TRCN0000194370 CACTGCCATTGCACTGTTATT pLKO.1 1644 3UTR 100% 13.200 7.920 N Eefsec n/a
3 TRCN0000292824 CACTGCCATTGCACTGTTATT pLKO_005 1644 3UTR 100% 13.200 7.920 N Eefsec n/a
4 TRCN0000154374 CAGATTTCCATCCCAACGAGA pLKO.1 389 5UTR 100% 2.640 1.584 N EEFSEC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477372 AACGCCATTCTTCTCATAGTACCG pLX_317 24.6% 55.1% 56.4% V5 (many diffs) n/a
Download CSV