Transcript: Mouse XM_006506585.1

PREDICTED: Mus musculus STAM binding protein (Stambp), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stambp (70527)
Length:
2702
CDS:
660..1934

Additional Resources:

NCBI RefSeq record:
XM_006506585.1
NBCI Gene record:
Stambp (70527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506585.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222488 GCCTTCTGTTCCTCTTGAAAT pLKO.1 2435 3UTR 100% 13.200 10.560 N Stambp n/a
2 TRCN0000349144 GCCTTCTGTTCCTCTTGAAAT pLKO_005 2435 3UTR 100% 13.200 10.560 N Stambp n/a
3 TRCN0000222489 CCAAAGAATATGAGCAGTATA pLKO.1 1003 CDS 100% 13.200 9.240 N Stambp n/a
4 TRCN0000316137 CCAAAGAATATGAGCAGTATA pLKO_005 1003 CDS 100% 13.200 9.240 N Stambp n/a
5 TRCN0000222492 GCAACATTGAACATGCCTTTA pLKO.1 820 CDS 100% 10.800 7.560 N Stambp n/a
6 TRCN0000316062 GCAACATTGAACATGCCTTTA pLKO_005 820 CDS 100% 10.800 7.560 N Stambp n/a
7 TRCN0000222491 CCGAGACTACAAATCAGCTAT pLKO.1 890 CDS 100% 4.950 3.465 N Stambp n/a
8 TRCN0000349145 CCGAGACTACAAATCAGCTAT pLKO_005 890 CDS 100% 4.950 3.465 N Stambp n/a
9 TRCN0000073976 TCCAGGAAACTGGATTCTTTA pLKO.1 1771 CDS 100% 1.320 0.924 N STAMBP n/a
10 TRCN0000299424 TCCAGGAAACTGGATTCTTTA pLKO_005 1771 CDS 100% 1.320 0.924 N STAMBP n/a
11 TRCN0000222490 CCGTAATCTGTGCTCAGAATT pLKO.1 1439 CDS 100% 0.000 0.000 N Stambp n/a
12 TRCN0000316136 CCGTAATCTGTGCTCAGAATT pLKO_005 1439 CDS 100% 0.000 0.000 N Stambp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506585.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.