Transcript: Mouse XM_006506748.3

PREDICTED: Mus musculus serine threonine kinase 31 (Stk31), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stk31 (77485)
Length:
3271
CDS:
130..3117

Additional Resources:

NCBI RefSeq record:
XM_006506748.3
NBCI Gene record:
Stk31 (77485)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234010 CTATCTGATGGTCCCATATTA pLKO_005 2478 CDS 100% 15.000 21.000 N Stk31 n/a
2 TRCN0000028817 CCGATCTGATATAGTAGAAAT pLKO.1 429 CDS 100% 13.200 18.480 N Stk31 n/a
3 TRCN0000234008 GAGTATGGCACTGTCGATATA pLKO_005 637 CDS 100% 13.200 18.480 N Stk31 n/a
4 TRCN0000361887 GGCCAAAGAAGGAACTAATAA pLKO_005 1512 CDS 100% 15.000 12.000 N Stk31 n/a
5 TRCN0000218940 ACCACTTGATAAACGCTTAAA pLKO_005 1446 CDS 100% 13.200 9.240 N Stk31 n/a
6 TRCN0000361886 AGTTTCATTTGGATGATAATG pLKO_005 2882 CDS 100% 13.200 9.240 N Stk31 n/a
7 TRCN0000234011 CATTGCATAGTGCTAACATAA pLKO_005 2594 CDS 100% 13.200 9.240 N Stk31 n/a
8 TRCN0000378415 GCAGGCAATCACGTGACATTT pLKO_005 877 CDS 100% 13.200 9.240 N Stk31 n/a
9 TRCN0000028758 CCAATGTGGATTACTTGCTTT pLKO.1 1934 CDS 100% 4.950 3.465 N Stk31 n/a
10 TRCN0000028841 GTCTGGATAGATATAGTGAAA pLKO.1 3068 CDS 100% 4.950 3.465 N Stk31 n/a
11 TRCN0000028838 GCTAAAGAAGAGTCTGGGTTA pLKO.1 2413 CDS 100% 4.050 2.835 N Stk31 n/a
12 TRCN0000028819 GCTGAAGAATTTGGCAGCTAA pLKO.1 1149 CDS 100% 4.950 2.970 N Stk31 n/a
13 TRCN0000196555 GACTTTAATTTAGGGTCTAAC pLKO.1 922 CDS 100% 10.800 8.640 N STK31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488677 CTAGCTAACCTGACGCCCCCGGGA pLX_317 11.5% 82.5% 77.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV