Transcript: Mouse XM_006506782.3

PREDICTED: Mus musculus bromodomain and PHD finger containing, 1 (Brpf1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Brpf1 (78783)
Length:
5249
CDS:
792..4553

Additional Resources:

NCBI RefSeq record:
XM_006506782.3
NBCI Gene record:
Brpf1 (78783)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281781 CCGCCCTCTGCACTGATTAAT pLKO_005 4619 3UTR 100% 15.000 21.000 N Brpf1 n/a
2 TRCN0000113508 CGCTACTTGAACTTTGATGAT pLKO.1 2862 CDS 100% 4.950 3.960 N Brpf1 n/a
3 TRCN0000271779 ACTACCGGTACATCGAGAAAT pLKO_005 1381 CDS 100% 13.200 9.240 N Brpf1 n/a
4 TRCN0000271777 ATGGATGAAGAGGACTATATC pLKO_005 1437 CDS 100% 13.200 9.240 N Brpf1 n/a
5 TRCN0000271780 CAAGGCCAAGTCTCGGATTAA pLKO_005 2246 CDS 100% 13.200 9.240 N Brpf1 n/a
6 TRCN0000113509 CGTACTTTGAGAGTCACAATA pLKO.1 1555 CDS 100% 13.200 9.240 N Brpf1 n/a
7 TRCN0000271778 ACTACTCAGGCGCCTACAAAC pLKO_005 2453 CDS 100% 10.800 7.560 N Brpf1 n/a
8 TRCN0000364128 TGCCGAGGCTATCCATCATAC pLKO_005 4185 CDS 100% 10.800 7.560 N BRPF1 n/a
9 TRCN0000021909 CCAATGGACTTACCAGCCAAT pLKO.1 3702 CDS 100% 4.050 2.835 N BRPF1 n/a
10 TRCN0000426275 CTCATTTGTAACTGCGTTTCC pLKO_005 5043 3UTR 100% 4.050 2.835 N BRPF1 n/a
11 TRCN0000113507 GCGGGCAACTAAGCCACCATA pLKO.1 833 CDS 100% 1.650 1.155 N Brpf1 n/a
12 TRCN0000113505 CCACAGTAAGAATACTGTAAA pLKO.1 4818 3UTR 100% 1.320 0.924 N Brpf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506782.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07183 pDONR223 100% 89.3% 95.5% None (many diffs) n/a
2 ccsbBroad304_07183 pLX_304 0% 89.3% 95.5% V5 (many diffs) n/a
3 TRCN0000491700 CTATGCAAATAGTTGCACTTATTA pLX_317 9.4% 89.3% 95.5% V5 (many diffs) n/a
Download CSV