Transcript: Mouse XM_006506954.3

PREDICTED: Mus musculus pyridine nucleotide-disulphide oxidoreductase domain 1 (Pyroxd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pyroxd1 (232491)
Length:
4918
CDS:
767..2059

Additional Resources:

NCBI RefSeq record:
XM_006506954.3
NBCI Gene record:
Pyroxd1 (232491)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200899 CATGGGACATCCTATTGACAT pLKO.1 1738 CDS 100% 4.950 6.930 N Pyroxd1 n/a
2 TRCN0000192866 GAGCCGTCTTAATTGGTGAAA pLKO.1 1929 CDS 100% 4.950 6.930 N Pyroxd1 n/a
3 TRCN0000201372 GCCATAAAGGATAACGCCATT pLKO.1 1073 CDS 100% 4.050 5.670 N Pyroxd1 n/a
4 TRCN0000192267 CAGAGGACAAGAGTATGTCAA pLKO.1 1879 CDS 100% 4.950 3.465 N Pyroxd1 n/a
5 TRCN0000191810 GAACCAAATCTAAAGCTGATT pLKO.1 1221 CDS 100% 4.950 2.970 N Pyroxd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04147 pDONR223 100% 71.7% 73.2% None (many diffs) n/a
2 ccsbBroad304_04147 pLX_304 0% 71.7% 73.2% V5 (many diffs) n/a
3 TRCN0000472946 CTCATCCCTGCACTGGGAGCTTCC pLX_317 26.3% 71.7% 73.2% V5 (many diffs) n/a
Download CSV