Transcript: Mouse XM_006507172.3

PREDICTED: Mus musculus nuclear mitotic apparatus protein 1 (Numa1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Numa1 (101706)
Length:
7441
CDS:
403..6729

Additional Resources:

NCBI RefSeq record:
XM_006507172.3
NBCI Gene record:
Numa1 (101706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072130 GCCAGATGGATCGAAAGATTA pLKO.1 1316 CDS 100% 13.200 18.480 N Numa1 n/a
2 TRCN0000309178 GCCAGATGGATCGAAAGATTA pLKO_005 1316 CDS 100% 13.200 18.480 N Numa1 n/a
3 TRCN0000311267 GGATCATGAGGAGTCGCTAAA pLKO_005 807 CDS 100% 10.800 15.120 N Numa1 n/a
4 TRCN0000072132 GCAGTAGAGATCCACAGTGAA pLKO.1 2935 CDS 100% 4.950 6.930 N Numa1 n/a
5 TRCN0000309177 GCAGTAGAGATCCACAGTGAA pLKO_005 2935 CDS 100% 4.950 6.930 N Numa1 n/a
6 TRCN0000348310 GATCATGAGGAGTCGCTAAAC pLKO_005 808 CDS 100% 10.800 8.640 N Numa1 n/a
7 TRCN0000305221 CTTGCAGCTGGACACTCTAAA pLKO_005 1632 CDS 100% 13.200 9.240 N Numa1 n/a
8 TRCN0000072128 CCTTAGTCTCTGGACCTAGAA pLKO.1 7078 3UTR 100% 4.950 3.465 N Numa1 n/a
9 TRCN0000309095 CCTTAGTCTCTGGACCTAGAA pLKO_005 7078 3UTR 100% 4.950 3.465 N Numa1 n/a
10 TRCN0000072129 GCAGCTAGAAACAGTGGAGAA pLKO.1 2196 CDS 100% 4.050 2.835 N Numa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15513 pDONR223 0% 39.5% 39.9% None (many diffs) n/a
2 ccsbBroad304_15513 pLX_304 0% 39.5% 39.9% V5 (many diffs) n/a
3 TRCN0000468294 CCTCAGGGAAGTGGGGACGCCAAT pLX_317 7.8% 39.5% 39.9% V5 (many diffs) n/a
Download CSV