Transcript: Mouse XM_006507464.1

PREDICTED: Mus musculus heparan sulfate (glucosamine) 3-O-sulfotransferase 2 (Hs3st2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hs3st2 (195646)
Length:
1906
CDS:
20..1174

Additional Resources:

NCBI RefSeq record:
XM_006507464.1
NBCI Gene record:
Hs3st2 (195646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241590 CTATCCGCATTGGCATGTATG pLKO_005 810 CDS 100% 10.800 15.120 N Hs3st2 n/a
2 TRCN0000241592 TGACTACACGCAGACTCTTTC pLKO_005 709 CDS 100% 10.800 15.120 N Hs3st2 n/a
3 TRCN0000241591 CAGATCGACCCTGAAGTTATA pLKO_005 1076 CDS 100% 13.200 9.240 N Hs3st2 n/a
4 TRCN0000241589 ACACTCAGTGGTGGGCGTAAT pLKO_005 1512 3UTR 100% 10.800 7.560 N Hs3st2 n/a
5 TRCN0000245370 CTGGTGAGATGGGTCGTATTC pLKO_005 915 CDS 100% 10.800 7.560 N Hs3st2 n/a
6 TRCN0000035848 ACAAGACCAAAGGATTCCCTT pLKO.1 987 CDS 100% 2.640 1.848 N HS3ST2 n/a
7 TRCN0000035817 CAAGCACTTCTACTTCAACAA pLKO.1 970 CDS 100% 4.950 2.475 Y HS3ST3B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02274 pDONR223 100% 80.9% 84.9% None (many diffs) n/a
2 ccsbBroad304_02274 pLX_304 0% 80.9% 84.9% V5 (many diffs) n/a
3 TRCN0000480039 TTGTAAAATTTGTTCCCGAGAGCC pLX_317 35% 80.9% 84.9% V5 (many diffs) n/a
Download CSV