Transcript: Mouse XM_006507521.2

PREDICTED: Mus musculus Sec23 interacting protein (Sec23ip), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec23ip (207352)
Length:
2835
CDS:
151..2451

Additional Resources:

NCBI RefSeq record:
XM_006507521.2
NBCI Gene record:
Sec23ip (207352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507521.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100629 CCTGCGCTTTAGAAGTATTAT pLKO.1 816 CDS 100% 15.000 21.000 N Sec23ip n/a
2 TRCN0000100628 CGCCGGATTGATTATGTTCTT pLKO.1 2284 CDS 100% 4.950 6.930 N Sec23ip n/a
3 TRCN0000100627 GCTGTTTCTAATGGAGTTATA pLKO.1 1267 CDS 100% 13.200 9.240 N Sec23ip n/a
4 TRCN0000432555 TCGCTCTTCAGAGTCACTTAT pLKO_005 2342 CDS 100% 13.200 9.240 N SEC23IP n/a
5 TRCN0000100626 CCCTCTTGTTACTTAAAGAAA pLKO.1 2387 CDS 100% 5.625 3.938 N Sec23ip n/a
6 TRCN0000100625 CAGAACAGAAAGATGCTGAAA pLKO.1 2610 3UTR 100% 4.950 2.970 N Sec23ip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507521.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14065 pDONR223 100% 65.8% 67.1% None (many diffs) n/a
2 ccsbBroad304_14065 pLX_304 0% 65.8% 67.1% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472422 AGGCCGGAGTGTTCCCAGATCCTT pLX_317 12.9% 65.8% 67.1% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV