Transcript: Mouse XM_006507575.3

PREDICTED: Mus musculus Tia1 cytotoxic granule-associated RNA binding protein-like 1 (Tial1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tial1 (21843)
Length:
5150
CDS:
1631..2389

Additional Resources:

NCBI RefSeq record:
XM_006507575.3
NBCI Gene record:
Tial1 (21843)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507575.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102618 GTACACAAGAAACTAACACTA pLKO.1 1806 CDS 100% 4.950 3.960 N Tial1 n/a
2 TRCN0000288454 GTACACAAGAAACTAACACTA pLKO_005 1806 CDS 100% 4.950 3.960 N Tial1 n/a
3 TRCN0000017210 CCACAACAGTATGGACAGTAT pLKO.1 2168 CDS 100% 4.950 3.465 N TIAL1 n/a
4 TRCN0000276257 CCACAACAGTATGGACAGTAT pLKO_005 2168 CDS 100% 4.950 3.465 N TIAL1 n/a
5 TRCN0000102617 CCCACAACAGTATGGACAGTA pLKO.1 2167 CDS 100% 4.950 3.465 N Tial1 n/a
6 TRCN0000102616 CCCTGTAATACCTCCTCCAAA pLKO.1 2329 CDS 100% 4.950 3.465 N Tial1 n/a
7 TRCN0000017209 CCCATATTGCTTTGTGGAATT pLKO.1 15 5UTR 100% 0.000 0.000 N TIAL1 n/a
8 TRCN0000276240 CCCATATTGCTTTGTGGAATT pLKO_005 15 5UTR 100% 0.000 0.000 N TIAL1 n/a
9 TRCN0000295717 TACCACCCTATGGAGTATATG pLKO_005 2208 CDS 100% 0.000 0.000 N Tial1 n/a
10 TRCN0000102615 CCTGTCACACTCTGAAGACAT pLKO.1 2435 3UTR 100% 4.950 2.970 N Tial1 n/a
11 TRCN0000288453 CCTGTCACACTCTGAAGACAT pLKO_005 2435 3UTR 100% 4.950 2.970 N Tial1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507575.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11188 pDONR223 100% 92.7% 98.8% None (many diffs) n/a
2 ccsbBroad304_11188 pLX_304 0% 92.7% 98.8% V5 (many diffs) n/a
3 TRCN0000481655 CGGTATAGCCGAATACCATTACCG pLX_317 57.3% 92.7% 98.8% V5 (many diffs) n/a
Download CSV