Transcript: Mouse XM_006507651.3

PREDICTED: Mus musculus post-GPI attachment to proteins 2 (Pgap2), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pgap2 (233575)
Length:
1930
CDS:
133..897

Additional Resources:

NCBI RefSeq record:
XM_006507651.3
NBCI Gene record:
Pgap2 (233575)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262951 ACTTCCGGCACAACATGTATT pLKO_005 734 CDS 100% 13.200 10.560 N Pgap2 n/a
2 TRCN0000215409 GCATTAACTTCAGTCTCAATG pLKO.1 473 CDS 100% 10.800 8.640 N Pgap2 n/a
3 TRCN0000281571 GCATTAACTTCAGTCTCAATG pLKO_005 473 CDS 100% 10.800 8.640 N Pgap2 n/a
4 TRCN0000262952 GGAACAAAGAGCTGCTAATAA pLKO_005 848 CDS 100% 15.000 10.500 N Pgap2 n/a
5 TRCN0000173815 CGGGAACAAAGAGCTGCTAAT pLKO.1 846 CDS 100% 10.800 7.560 N Pgap2 n/a
6 TRCN0000262950 TCTTGACAGCCTTCGCCTATT pLKO_005 398 CDS 100% 10.800 7.560 N Pgap2 n/a
7 TRCN0000194557 GCTCTTCGTCATCAACTTCAT pLKO.1 687 CDS 100% 4.950 3.465 N Pgap2 n/a
8 TRCN0000262949 TCCCTATCTCCACGTTCTCTC pLKO_005 939 3UTR 100% 4.050 2.835 N Pgap2 n/a
9 TRCN0000173445 CGTCATCAACTTCATCTCCTT pLKO.1 693 CDS 100% 2.640 1.848 N Pgap2 n/a
10 TRCN0000181017 GCACATGCCTTTAATCCCAAT pLKO.1 1601 3UTR 100% 4.050 2.025 Y Map6d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11863 pDONR223 100% 89.8% 92.9% None (many diffs) n/a
2 ccsbBroad304_11863 pLX_304 0% 89.8% 92.9% V5 (many diffs) n/a
3 TRCN0000479879 CTTACCATCGGGAACAGGAACCTC pLX_317 46.6% 89.8% 92.9% V5 (many diffs) n/a
Download CSV