Transcript: Mouse XM_006507700.2

PREDICTED: Mus musculus component of oligomeric golgi complex 7 (Cog7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cog7 (233824)
Length:
2870
CDS:
122..2404

Additional Resources:

NCBI RefSeq record:
XM_006507700.2
NBCI Gene record:
Cog7 (233824)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177166 GCCAGTTTAATGGAAATACTT pLKO.1 1685 CDS 100% 5.625 7.875 N Cog7 n/a
2 TRCN0000181434 CGACATCGACTATCTGATCAA pLKO.1 2230 CDS 100% 4.950 6.930 N Cog7 n/a
3 TRCN0000130679 CGACTATCTGATCAACGTGAT pLKO.1 2236 CDS 100% 4.050 5.670 N COG7 n/a
4 TRCN0000344165 CGACTATCTGATCAACGTGAT pLKO_005 2236 CDS 100% 4.050 5.670 N COG7 n/a
5 TRCN0000181558 GTTTACTGAAATCGACCGGAT pLKO.1 751 CDS 100% 2.160 3.024 N Cog7 n/a
6 TRCN0000181649 GCTGTGTATGGTCCCTATAAA pLKO.1 1169 CDS 100% 15.000 10.500 N Cog7 n/a
7 TRCN0000217631 GAAATTAGGCATGGTGGTATG pLKO.1 2615 3UTR 100% 6.000 4.200 N Cog7 n/a
8 TRCN0000129322 CCCTGCTGAATATGCCAGTTT pLKO.1 1672 CDS 100% 4.950 3.465 N COG7 n/a
9 TRCN0000181928 GCTTGATGATGCTTGTGGATA pLKO.1 600 CDS 100% 4.950 2.970 N Cog7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04565 pDONR223 100% 84.2% 88.3% None (many diffs) n/a
2 ccsbBroad304_04565 pLX_304 0% 84.2% 88.3% V5 (many diffs) n/a
3 TRCN0000491906 CCAATACACGAATACATAGTTTTC pLX_317 14% 84.2% 88.3% V5 (many diffs) n/a
Download CSV