Transcript: Mouse XM_006507719.3

PREDICTED: Mus musculus Tu translation elongation factor, mitochondrial (Tufm), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tufm (233870)
Length:
1606
CDS:
95..1369

Additional Resources:

NCBI RefSeq record:
XM_006507719.3
NBCI Gene record:
Tufm (233870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507719.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164867 GCTCACCGAGTTTGGCTATAA pLKO.1 700 CDS 100% 13.200 18.480 N TUFM n/a
2 TRCN0000280863 GCTCACCGAGTTTGGCTATAA pLKO_005 700 CDS 100% 13.200 18.480 N TUFM n/a
3 TRCN0000196164 GCTTAGTCTAATCTTGCGGCA pLKO.1 1225 CDS 100% 0.540 0.756 N Tufm n/a
4 TRCN0000216957 CTCACCGAGTTTGGCTATAAA pLKO.1 701 CDS 100% 15.000 10.500 N Tufm n/a
5 TRCN0000248735 CTCACCGAGTTTGGCTATAAA pLKO_005 701 CDS 100% 15.000 10.500 N Tufm n/a
6 TRCN0000215321 CAAACCCTTTGTATCTCATTT pLKO.1 1111 CDS 100% 13.200 9.240 N Tufm n/a
7 TRCN0000248736 CAAACCCTTTGTATCTCATTT pLKO_005 1111 CDS 100% 13.200 9.240 N Tufm n/a
8 TRCN0000248734 GGACTTCTGCTCAGGTTATTG pLKO_005 1374 3UTR 100% 13.200 9.240 N Tufm n/a
9 TRCN0000248733 GGACTTGAAGCTTAGTCTAAT pLKO_005 1216 CDS 100% 13.200 9.240 N Tufm n/a
10 TRCN0000248737 AGCACTTACTGCTAGCTAAAC pLKO_005 582 CDS 100% 10.800 7.560 N Tufm n/a
11 TRCN0000196122 GCAGCCCATGATCTTAGAGAA pLKO.1 1243 CDS 100% 4.950 3.465 N Tufm n/a
12 TRCN0000216536 GTAGAGTCAGTCTACTCTATT pLKO.1 878 CDS 100% 1.320 0.924 N Tufm n/a
13 TRCN0000195806 CAGGTTATTGAGCTTCAGGCT pLKO.1 1385 3UTR 100% 0.660 0.462 N Tufm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507719.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01726 pDONR223 100% 81% 87% None (many diffs) n/a
2 ccsbBroad304_01726 pLX_304 0% 81% 87% V5 (many diffs) n/a
3 TRCN0000471914 ATCAGCGGTGTTGTCGCTGATTTA pLX_317 35.3% 81% 87% V5 (many diffs) n/a
Download CSV