Transcript: Mouse XM_006507736.3

PREDICTED: Mus musculus potassium channel tetramerisation domain containing 13 (Kctd13), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kctd13 (233877)
Length:
1484
CDS:
212..1027

Additional Resources:

NCBI RefSeq record:
XM_006507736.3
NBCI Gene record:
Kctd13 (233877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069499 CCCGAACAGCAAGTATGTGAA pLKO.1 322 CDS 100% 4.950 6.930 N Kctd13 n/a
2 TRCN0000044100 CAACCGCAGTAACAACAAGTA pLKO.1 736 CDS 100% 4.950 3.465 N KCTD13 n/a
3 TRCN0000300279 CAACCGCAGTAACAACAAGTA pLKO_005 736 CDS 100% 4.950 3.465 N KCTD13 n/a
4 TRCN0000044102 CACCAGCACTTCAGATGACAA pLKO.1 763 CDS 100% 4.950 3.465 N KCTD13 n/a
5 TRCN0000310612 CACCAGCACTTCAGATGACAA pLKO_005 763 CDS 100% 4.950 3.465 N KCTD13 n/a
6 TRCN0000069498 GCTTCTACACAACCGCAGTAA pLKO.1 727 CDS 100% 4.950 3.465 N Kctd13 n/a
7 TRCN0000069501 GTGCTGTACCTCCATAGTCTA pLKO.1 919 CDS 100% 4.950 3.465 N Kctd13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05294 pDONR223 100% 71.3% 70.9% None (many diffs) n/a
2 ccsbBroad304_05294 pLX_304 0% 71.3% 70.9% V5 (many diffs) n/a
3 TRCN0000474705 AACACTTAGAATGTCGTCGGGTGC pLX_317 38.5% 71.3% 70.9% V5 (many diffs) n/a
Download CSV