Transcript: Mouse XM_006507904.2

PREDICTED: Mus musculus acyl-CoA synthetase medium-chain family member 5 (Acsm5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acsm5 (272428)
Length:
2679
CDS:
374..2149

Additional Resources:

NCBI RefSeq record:
XM_006507904.2
NBCI Gene record:
Acsm5 (272428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157454 GCCAAAGACGGTTTCTGGAAA pLKO.1 2086 CDS 100% 4.950 3.960 N ACSM5 n/a
2 TRCN0000112432 CCAATGTCTGAGGCACTGTTT pLKO.1 1420 CDS 100% 4.950 3.465 N Acsm5 n/a
3 TRCN0000112434 CCACCTTACGATGTGCAGATT pLKO.1 1598 CDS 100% 4.950 3.465 N Acsm5 n/a
4 TRCN0000112433 CCTAAGGAGTAAATTGAGAAA pLKO.1 2110 CDS 100% 4.950 3.465 N Acsm5 n/a
5 TRCN0000112430 CCTTCCATTTAGACACACTTT pLKO.1 2551 3UTR 100% 4.950 3.465 N Acsm5 n/a
6 TRCN0000112431 GCCTTGACTGAGTCTGACATA pLKO.1 1187 CDS 100% 4.950 3.465 N Acsm5 n/a
7 TRCN0000155464 GAGAGGTGGTAAAGGCATTTA pLKO.1 1941 CDS 100% 13.200 7.920 N ACSM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08442 pDONR223 100% 82.2% 84.1% None (many diffs) n/a
2 ccsbBroad304_08442 pLX_304 0% 82.2% 84.1% V5 (many diffs) n/a
3 TRCN0000469405 CTCCTATAGCGATTTTCTCCCCGC pLX_317 22.4% 82.2% 84.1% V5 (many diffs) n/a
Download CSV