Transcript: Mouse XM_006508036.2

PREDICTED: Mus musculus carboxypeptidase X 2 (M14 family) (Cpxm2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpxm2 (55987)
Length:
2715
CDS:
48..1637

Additional Resources:

NCBI RefSeq record:
XM_006508036.2
NBCI Gene record:
Cpxm2 (55987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031323 CCGGATCCTAATAACTATTAT pLKO.1 252 CDS 100% 15.000 21.000 N Cpxm2 n/a
2 TRCN0000437547 CTACTGAACCCTGGCGAATAT pLKO_005 1407 CDS 100% 13.200 18.480 N Cpxm2 n/a
3 TRCN0000443890 AGGTTCATCGAGGCATCAAAG pLKO_005 1282 CDS 100% 10.800 15.120 N Cpxm2 n/a
4 TRCN0000031319 CCAGATGTTATCATTTGAGAT pLKO.1 2054 3UTR 100% 4.950 3.960 N Cpxm2 n/a
5 TRCN0000432230 ACAACAACTTTCCGGATTTAA pLKO_005 724 CDS 100% 15.000 10.500 N Cpxm2 n/a
6 TRCN0000073884 CCCTCAGTCCTGGTTTGATAA pLKO.1 188 CDS 100% 13.200 9.240 N CPXM2 n/a
7 TRCN0000031322 CCTGGCTAGGATAAGAGAAAT pLKO.1 1532 CDS 100% 13.200 9.240 N Cpxm2 n/a
8 TRCN0000031320 GCACCACAACTATAAGGAAAT pLKO.1 317 CDS 100% 10.800 7.560 N Cpxm2 n/a
9 TRCN0000031321 CGACATGATATTTGAAGGAAA pLKO.1 98 CDS 100% 4.950 3.465 N Cpxm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09463 pDONR223 100% 61.3% 66.4% None (many diffs) n/a
2 ccsbBroad304_09463 pLX_304 0% 61.3% 66.4% V5 (many diffs) n/a
3 TRCN0000475417 CACGCTTTGGTTGTTCGATGCTAA pLX_317 10.6% 61.3% 66.4% V5 (many diffs) n/a
Download CSV