Transcript: Mouse XM_006508161.2

PREDICTED: Mus musculus BTB (POZ) domain containing 10 (Btbd10), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Btbd10 (68815)
Length:
4191
CDS:
2110..3393

Additional Resources:

NCBI RefSeq record:
XM_006508161.2
NBCI Gene record:
Btbd10 (68815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251936 GTGATGCACAGTATAACATAA pLKO_005 3806 3UTR 100% 13.200 18.480 N Btbd10 n/a
2 TRCN0000251938 CCAACAAGGCAGCATCATATT pLKO_005 2242 CDS 100% 13.200 9.240 N Btbd10 n/a
3 TRCN0000251939 CTACTGTGTTTCGAGCTATTT pLKO_005 2630 CDS 100% 13.200 9.240 N Btbd10 n/a
4 TRCN0000215716 CTTACTCCTTGTATTCGAAAT pLKO.1 2212 CDS 100% 10.800 7.560 N Btbd10 n/a
5 TRCN0000251935 CTTACTCCTTGTATTCGAAAT pLKO_005 2212 CDS 100% 10.800 7.560 N Btbd10 n/a
6 TRCN0000179634 GAAGGCTATCCTACCTACAAA pLKO.1 3079 CDS 100% 5.625 3.938 N Btbd10 n/a
7 TRCN0000196195 GCATCCTCGTTCGAGTTCTAT pLKO.1 3568 3UTR 100% 5.625 3.938 N Btbd10 n/a
8 TRCN0000183240 GTGATTACCTTTGTATCTCTT pLKO.1 2720 CDS 100% 4.950 3.465 N Btbd10 n/a
9 TRCN0000201485 CCTCTTGAGTGCTGGGATTAA pLKO.1 168 5UTR 100% 13.200 6.600 Y D830050J10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508161.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12801 pDONR223 100% 39.8% 42.3% None (many diffs) n/a
2 ccsbBroad304_12801 pLX_304 0% 39.8% 42.3% V5 (many diffs) n/a
3 TRCN0000465665 AAACGACCTCCGCTAAAGCCTCCC pLX_317 54.8% 39.8% 42.3% V5 (many diffs) n/a
Download CSV