Transcript: Mouse XM_006508205.1

PREDICTED: Mus musculus phosphoglucomutase 2-like 1 (Pgm2l1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pgm2l1 (70974)
Length:
2337
CDS:
307..2172

Additional Resources:

NCBI RefSeq record:
XM_006508205.1
NBCI Gene record:
Pgm2l1 (70974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249634 CCTACACCTTTCGTACCATAT pLKO_005 763 CDS 100% 10.800 15.120 N Pgm2l1 n/a
2 TRCN0000249633 TAGGGCACATCAGTACGTTAT pLKO_005 2170 CDS 100% 10.800 15.120 N Pgm2l1 n/a
3 TRCN0000249636 ATGGATTGGAAGTAGGATAAA pLKO_005 1542 CDS 100% 13.200 9.240 N Pgm2l1 n/a
4 TRCN0000216991 CATAACCACTGGATATGATAG pLKO.1 1893 CDS 100% 10.800 7.560 N Pgm2l1 n/a
5 TRCN0000249635 CATAACCACTGGATATGATAG pLKO_005 1893 CDS 100% 10.800 7.560 N Pgm2l1 n/a
6 TRCN0000049091 GCACTTAAAGAAGGATTTCAT pLKO.1 1495 CDS 100% 5.625 3.938 N PGM2L1 n/a
7 TRCN0000202218 CGTTGGGACAAGAATCCCAAA pLKO.1 406 CDS 100% 0.405 0.284 N Pgm2l1 n/a
8 TRCN0000435207 CAGTTGCAGGTGTGATGATTA pLKO_005 803 CDS 100% 13.200 7.920 N PGM2L1 n/a
9 TRCN0000413695 ATGGATTGGAAGTAGGATAAT pLKO_005 1542 CDS 100% 13.200 9.240 N PGM2L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09936 pDONR223 100% 89.8% 93.2% None (many diffs) n/a
2 ccsbBroad304_09936 pLX_304 0% 89.8% 93.2% V5 (many diffs) n/a
3 TRCN0000478596 TTCTCAGGCTTTGGCAACTATCTC pLX_317 16.3% 89.8% 93.2% V5 (many diffs) n/a
Download CSV