Transcript: Mouse XM_006508475.2

PREDICTED: Mus musculus cortactin (Cttn), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cttn (13043)
Length:
1326
CDS:
411..1259

Additional Resources:

NCBI RefSeq record:
XM_006508475.2
NBCI Gene record:
Cttn (13043)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108893 GCACGAATCCCAGAAAGACTA pLKO.1 1073 CDS 100% 4.950 6.930 N Cttn n/a
2 TRCN0000335299 GCACGAATCCCAGAAAGACTA pLKO_005 1073 CDS 100% 4.950 6.930 N Cttn n/a
3 TRCN0000108890 CCTCCCAGAAAGACTACTCTA pLKO.1 856 CDS 100% 4.950 3.465 N Cttn n/a
4 TRCN0000108891 GAAAGATTACTCCAAAGGTTT pLKO.1 974 CDS 100% 4.950 3.465 N Cttn n/a
5 TRCN0000335233 GAAAGATTACTCCAAAGGTTT pLKO_005 974 CDS 100% 4.950 3.465 N Cttn n/a
6 TRCN0000108894 CTTCGAGAGAATGTCTTCCAA pLKO.1 582 CDS 100% 3.000 2.100 N Cttn n/a
7 TRCN0000335232 CTTCGAGAGAATGTCTTCCAA pLKO_005 582 CDS 100% 3.000 2.100 N Cttn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06159 pDONR223 100% 48.4% 53.9% None (many diffs) n/a
2 ccsbBroad304_06159 pLX_304 0% 48.4% 53.9% V5 (many diffs) n/a
3 TRCN0000465868 TCGACCCCGAATAAACTTGGCATC pLX_317 26% 48.4% 53.9% V5 (many diffs) n/a
Download CSV