Transcript: Mouse XM_006508563.3

PREDICTED: Mus musculus troponin T3, skeletal, fast (Tnnt3), transcript variant X16, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnnt3 (21957)
Length:
1250
CDS:
144..1235

Additional Resources:

NCBI RefSeq record:
XM_006508563.3
NBCI Gene record:
Tnnt3 (21957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120544 GAGGAGCTAATCGCACTTAAA pLKO.1 390 CDS 100% 13.200 9.240 N Tnnt3 n/a
2 TRCN0000120546 ACCCAAACTTACTGCTCCTAA pLKO.1 251 CDS 100% 4.950 3.465 N Tnnt3 n/a
3 TRCN0000120542 CCTCTGAACATTGACCATCTT pLKO.1 684 CDS 100% 4.950 3.465 N Tnnt3 n/a
4 TRCN0000120543 GCCACTTTGAAGCTAGAAAGA pLKO.1 361 CDS 100% 4.950 3.465 N Tnnt3 n/a
5 TRCN0000120545 GCAAAGAATTCGCGCTGAGAA pLKO.1 449 CDS 100% 0.000 0.000 N Tnnt3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01694 pDONR223 100% 55.5% 56.9% None (many diffs) n/a
2 ccsbBroad304_01694 pLX_304 0% 55.5% 56.9% V5 (many diffs) n/a
3 TRCN0000470757 CTCGCATCGCGGTAGACAAGGGCC pLX_317 52.9% 55.5% 56.9% V5 (many diffs) n/a
Download CSV