Transcript: Mouse XM_006508659.3

PREDICTED: Mus musculus oxysterol binding protein-like 5 (Osbpl5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Osbpl5 (79196)
Length:
4392
CDS:
855..3335

Additional Resources:

NCBI RefSeq record:
XM_006508659.3
NBCI Gene record:
Osbpl5 (79196)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375199 AGGAATGGCGCTACCGATATG pLKO_005 2815 CDS 100% 10.800 15.120 N Osbpl5 n/a
2 TRCN0000349943 TAATCGCAAGGAGGAGTATAC pLKO_005 2279 CDS 100% 10.800 15.120 N Osbpl5 n/a
3 TRCN0000313790 GTACCGGCCTTAACGCTAAAG pLKO_005 3560 3UTR 100% 0.000 0.000 N Osbpl5 n/a
4 TRCN0000313858 GGCATCAAGAAACCCTATAAT pLKO_005 2034 CDS 100% 15.000 10.500 N Osbpl5 n/a
5 TRCN0000105112 GCGCCAACATCAACCAGATTT pLKO.1 2443 CDS 100% 13.200 9.240 N Osbpl5 n/a
6 TRCN0000375267 GTCAGCTATTCATTAACTATA pLKO_005 3304 CDS 100% 13.200 9.240 N Osbpl5 n/a
7 TRCN0000105113 GCTGAAGGACATTGCCCAATA pLKO.1 2858 CDS 100% 10.800 7.560 N Osbpl5 n/a
8 TRCN0000105114 AGCGCCAACATCAACCAGATT pLKO.1 2442 CDS 100% 4.950 3.465 N Osbpl5 n/a
9 TRCN0000105111 GCAATGGATCTGACAAGGAAT pLKO.1 946 CDS 100% 4.950 3.465 N Osbpl5 n/a
10 TRCN0000317445 GCAATGGATCTGACAAGGAAT pLKO_005 946 CDS 100% 4.950 3.465 N Osbpl5 n/a
11 TRCN0000105110 GCCATCTCCATTGTATCTGAT pLKO.1 4274 3UTR 100% 4.950 3.465 N Osbpl5 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 614 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04664 pDONR223 100% 78.3% 80.4% None (many diffs) n/a
2 ccsbBroad304_04664 pLX_304 0% 78.3% 80.4% V5 (many diffs) n/a
3 TRCN0000470065 ACGGAACTTAACTCCTAGGGTGTT pLX_317 15.7% 78.3% 80.4% V5 (many diffs) n/a
Download CSV