Transcript: Mouse XM_006509045.2

PREDICTED: Mus musculus asparagine-linked glycosylation 11 (alpha-1,2-mannosyltransferase) (Alg11), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Alg11 (207958)
Length:
5064
CDS:
186..1589

Additional Resources:

NCBI RefSeq record:
XM_006509045.2
NBCI Gene record:
Alg11 (207958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093732 AGTGACATAGTCATGGTTAAT pLKO.1 861 CDS 100% 13.200 18.480 N Alg11 n/a
2 TRCN0000093733 CCAGGAGTTTGAAGTAGCATT pLKO.1 1538 CDS 100% 4.950 6.930 N Alg11 n/a
3 TRCN0000093730 GCAGTGACATAGTCATGGTTA pLKO.1 859 CDS 100% 4.950 6.930 N Alg11 n/a
4 TRCN0000093731 CCTTGTGATGTGCAGACATTT pLKO.1 951 CDS 100% 13.200 9.240 N Alg11 n/a
5 TRCN0000093729 GCTGACTCTATGGCTCACATT pLKO.1 1446 CDS 100% 4.950 3.465 N Alg11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509045.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10161 pDONR223 100% 82% 82.3% None (many diffs) n/a
2 ccsbBroad304_10161 pLX_304 0% 82% 82.3% V5 (many diffs) n/a
3 TRCN0000476301 TTGAAACACCAATGATCCTCACAC pLX_317 24.2% 82% 82.3% V5 (many diffs) n/a
Download CSV