Transcript: Mouse XM_006509206.2

PREDICTED: Mus musculus purine-rich element binding protein G (Purg), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Purg (75029)
Length:
3612
CDS:
453..1505

Additional Resources:

NCBI RefSeq record:
XM_006509206.2
NBCI Gene record:
Purg (75029)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103473 CCTAAGCAAGAGTAGACTCTA pLKO.1 533 CDS 100% 4.950 3.960 N Purg n/a
2 TRCN0000162068 CCTAAGCAAGAGTAGACTCTA pLKO.1 533 CDS 100% 4.950 3.960 N PURG n/a
3 TRCN0000103474 CGCTTCCTAAGGATTAGACAA pLKO.1 1041 CDS 100% 4.950 3.960 N Purg n/a
4 TRCN0000103470 GCACAAGGTATGATTGAATTT pLKO.1 1137 CDS 100% 13.200 9.240 N Purg n/a
5 TRCN0000103472 GCTTCCTAAGGATTAGACAAA pLKO.1 1042 CDS 100% 4.950 3.465 N Purg n/a
6 TRCN0000103471 CGCTTCCTAAAGATAGCCGAA pLKO.1 708 CDS 100% 2.160 1.512 N Purg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03114 pDONR223 100% 93.2% 96.2% None (many diffs) n/a
2 ccsbBroad304_03114 pLX_304 0% 93.2% 96.2% V5 (many diffs) n/a
3 TRCN0000473148 AACTTGAGCCAGGTTGGCCTTTAT pLX_317 20.3% 93.2% 96.2% V5 (many diffs) n/a
Download CSV