Transcript: Mouse XM_006509307.3

PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 7 (Cnot7), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnot7 (18983)
Length:
3129
CDS:
1144..1683

Additional Resources:

NCBI RefSeq record:
XM_006509307.3
NBCI Gene record:
Cnot7 (18983)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509307.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017869 GCTACTAACAACATCTGGTAT pLKO.1 1167 CDS 100% 4.950 3.960 N CNOT7 n/a
2 TRCN0000095978 CCAAATACTGTGGTCACTTAT pLKO.1 1583 CDS 100% 13.200 9.240 N Cnot7 n/a
3 TRCN0000095974 CCTTCTATTCTGCAGTACTTA pLKO.1 2022 3UTR 100% 5.625 3.938 N Cnot7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509307.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03097 pDONR223 100% 58.1% 62.4% None (many diffs) n/a
2 ccsbBroad304_03097 pLX_304 0% 58.1% 62.4% V5 (many diffs) n/a
3 TRCN0000466126 TCGAGCCATATCGGGGGAGGTCTG pLX_317 43.4% 58.1% 62.4% V5 (many diffs) n/a
4 ccsbBroadEn_11909 pDONR223 100% 45.1% 48.4% None (many diffs) n/a
5 ccsbBroad304_11909 pLX_304 0% 45.1% 48.4% V5 (many diffs) n/a
6 TRCN0000475112 AAGTTTTCGTATTTGATCATCATC pLX_317 49.3% 45.1% 48.4% V5 (many diffs) n/a
Download CSV