Transcript: Mouse XM_006509498.2

PREDICTED: Mus musculus centromere protein U (Cenpu), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cenpu (71876)
Length:
4062
CDS:
69..1286

Additional Resources:

NCBI RefSeq record:
XM_006509498.2
NBCI Gene record:
Cenpu (71876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216239 CGTTGAGTTAAGGTATGAAAT pLKO.1 2140 3UTR 100% 13.200 10.560 N Cenpu n/a
2 TRCN0000175533 CGGGAAAGTATGATTCATCTA pLKO.1 1165 CDS 100% 4.950 3.960 N Cenpu n/a
3 TRCN0000215834 CAGGATGAACTGATTCGATTA pLKO.1 999 CDS 100% 10.800 7.560 N Cenpu n/a
4 TRCN0000194126 GAACGGGAAAGTATGATTCAT pLKO.1 1162 CDS 100% 5.625 3.938 N Cenpu n/a
5 TRCN0000175590 CGTCTGCTGAAATATGTCAAA pLKO.1 1586 3UTR 100% 4.950 3.465 N Cenpu n/a
6 TRCN0000175682 GAAAGGAGAACTCATCAGAAT pLKO.1 884 CDS 100% 4.950 3.465 N Cenpu n/a
7 TRCN0000176233 GAACACTTTGAGAAGCACATA pLKO.1 125 CDS 100% 4.950 3.465 N Cenpu n/a
8 TRCN0000174629 GAGTAGAATCTGAAAGTTGTA pLKO.1 832 CDS 100% 4.950 3.465 N Cenpu n/a
9 TRCN0000173705 CCTGGAGTATAAGCAAAGAGT pLKO.1 815 CDS 100% 3.000 2.100 N Cenpu n/a
10 TRCN0000215812 CATAACGGAGTTGGATGTTAT pLKO.1 770 CDS 100% 1.320 0.924 N Cenpu n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.