Transcript: Mouse XM_006509855.3

PREDICTED: Mus musculus yes-associated protein 1 (Yap1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Yap1 (22601)
Length:
2509
CDS:
201..1637

Additional Resources:

NCBI RefSeq record:
XM_006509855.3
NBCI Gene record:
Yap1 (22601)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238434 ACTTGGAGGCGCTCTTCAATG pLKO_005 346 CDS 100% 10.800 15.120 N Yap1 n/a
2 TRCN0000095866 CGGTTGAAACAACAGGAATTA pLKO.1 1116 CDS 100% 13.200 10.560 N Yap1 n/a
3 TRCN0000095865 CCACCAAGCTAGATAAAGAAA pLKO.1 1597 CDS 100% 5.625 4.500 N Yap1 n/a
4 TRCN0000095868 CTGGTCAAAGATACTTCTTAA pLKO.1 706 CDS 100% 13.200 9.240 N Yap1 n/a
5 TRCN0000095864 GCAGACAGATTCCTTTGTTAA pLKO.1 1844 3UTR 100% 13.200 9.240 N Yap1 n/a
6 TRCN0000238436 TGAGAACAATGACAACCAATA pLKO_005 1246 CDS 100% 10.800 7.560 N Yap1 n/a
7 TRCN0000107266 GCCACCAAGCTAGATAAAGAA pLKO.1 1596 CDS 100% 5.625 3.938 N YAP1 n/a
8 TRCN0000300325 GCCACCAAGCTAGATAAAGAA pLKO_005 1596 CDS 100% 5.625 3.938 N YAP1 n/a
9 TRCN0000095867 GCGGTTGAAACAACAGGAATT pLKO.1 1115 CDS 100% 0.000 0.000 N Yap1 n/a
10 TRCN0000238433 TCCAACCAGCAGCAGCAAATA pLKO_005 1059 CDS 100% 13.200 7.920 N Yap1 n/a
11 TRCN0000238432 GAAGCGCTGAGTTCCGAAATC pLKO_005 1551 CDS 100% 10.800 6.480 N Yap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07601 pDONR223 100% 82.8% 85.7% None (many diffs) n/a
2 ccsbBroad304_07601 pLX_304 43.6% 82.8% 85.7% V5 (many diffs) n/a
3 TRCN0000477457 ACATGTTCCTATACTGTTACCAAT pLX_317 19.9% 82.8% 85.7% V5 (many diffs) n/a
Download CSV