Construct: ORF TRCN0000477457
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010625.1_s317c1
- Derived from:
- ccsbBroadEn_07601
- DNA Barcode:
- ACATGTTCCTATACTGTTACCAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- YAP1 (10413)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477457
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10413 | YAP1 | Yes associated protein 1 | NM_001130145.3 | 99.8% | 99.8% | 1491A>C;1510T>C |
2 | human | 10413 | YAP1 | Yes associated protein 1 | XM_005271380.3 | 99.4% | 99.4% | 802_807delGGTAAA;1497A>C;1516T>C |
3 | human | 10413 | YAP1 | Yes associated protein 1 | NM_001282101.1 | 99% | 99% | 982_993del;1503A>C;1522T>C |
4 | human | 10413 | YAP1 | Yes associated protein 1 | XM_005271378.3 | 98.6% | 98.6% | (many diffs) |
5 | human | 10413 | YAP1 | Yes associated protein 1 | NM_001282100.1 | 97.4% | 97% | (many diffs) |
6 | human | 10413 | YAP1 | Yes associated protein 1 | XM_005271381.3 | 97% | 96.6% | (many diffs) |
7 | human | 10413 | YAP1 | Yes associated protein 1 | NM_001195044.2 | 96.6% | 96.6% | 981_982ins48;1443A>C;1462T>C |
8 | human | 10413 | YAP1 | Yes associated protein 1 | XM_005271383.3 | 96.3% | 96.2% | (many diffs) |
9 | human | 10413 | YAP1 | Yes associated protein 1 | NM_001282097.2 | 92.3% | 92.2% | 687_688ins114;1377A>C;1396T>C |
10 | human | 10413 | YAP1 | Yes associated protein 1 | NM_001282099.1 | 91.6% | 91.5% | (many diffs) |
11 | human | 10413 | YAP1 | Yes associated protein 1 | NM_001282098.2 | 89.8% | 89.4% | (many diffs) |
12 | human | 10413 | YAP1 | Yes associated protein 1 | NM_006106.5 | 89.1% | 89% | (many diffs) |
13 | human | 10413 | YAP1 | Yes associated protein 1 | NM_001195045.2 | 64.5% | 64.4% | 0_1ins534;957A>C;976T>C |
14 | human | 10413 | YAP1 | Yes associated protein 1 | XM_011542556.2 | 64% | 63.9% | (many diffs) |
15 | human | 10413 | YAP1 | Yes associated protein 1 | XM_011542555.2 | 63.7% | 63.7% | (many diffs) |
16 | human | 10413 | YAP1 | Yes associated protein 1 | XM_017017093.1 | 61.3% | 61.3% | (many diffs) |
17 | mouse | 22601 | Yap1 | yes-associated protein 1 | NM_001171147.1 | 85.5% | 88.4% | (many diffs) |
18 | mouse | 22601 | Yap1 | yes-associated protein 1 | XM_006509854.3 | 85.1% | 88.1% | (many diffs) |
19 | mouse | 22601 | Yap1 | yes-associated protein 1 | XM_006509853.3 | 84.8% | 87.7% | (many diffs) |
20 | mouse | 22601 | Yap1 | yes-associated protein 1 | XM_006509852.2 | 84.5% | 87.4% | (many diffs) |
21 | mouse | 22601 | Yap1 | yes-associated protein 1 | XM_006509856.3 | 83.1% | 86.1% | (many diffs) |
22 | mouse | 22601 | Yap1 | yes-associated protein 1 | XM_006509855.3 | 82.8% | 85.7% | (many diffs) |
23 | mouse | 22601 | Yap1 | yes-associated protein 1 | NM_009534.3 | 82.4% | 85.7% | (many diffs) |
24 | mouse | 22601 | Yap1 | yes-associated protein 1 | XM_006509857.3 | 82.1% | 85.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1578
- ORF length:
- 1512
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tcccgggcag cagccgccgc ctcaaccggc cccccagggc caagggcagc 121 cgccttcgca gcccccgcag gggcagggcc cgccgtccgg acccgggcaa ccggcacccg 181 cggcgaccca ggcggcgccg caggcacccc ccgccgggca tcagatcgtg cacgtccgcg 241 gggactcgga gaccgacctg gaggcgctct tcaacgccgt catgaacccc aagacggcca 301 acgtgcccca gaccgtgccc atgaggctcc ggaagctgcc cgactccttc ttcaagccgc 361 cggagcccaa atcccactcc cgacaggcca gtactgatgc aggcactgca ggagccctga 421 ctccacagca tgttcgagct cattcctctc cagcttctct gcagttggga gctgtttctc 481 ctgggacact gacccccact ggagtagtct ctggcccagc agctacaccc acagctcagc 541 atcttcgaca gtcttctttt gagatacctg atgatgtacc tctgccagca ggttgggaga 601 tggcaaagac atcttctggt cagagatact tcttaaatca catcgatcag acaacaacat 661 ggcaggaccc caggaaggcc atgctgtccc agatgaacgt cacagccccc accagtccac 721 cagtgcagca gaatatgatg aactcggctt caggtcctct tcctgatgga tgggaacaag 781 ccatgactca ggatggagaa atttactata taaaccataa gaacaagacc acctcttggc 841 tagacccaag gcttgaccct cgttttgcca tgaaccagag aatcagtcag agtgctccag 901 tgaaacagcc accacccctg gctccccaga gcccacaggg aggcgtcatg ggtggcagca 961 actccaacca gcagcaacag atgcgactgc agcaactgca gatggagaag gagaggctgc 1021 ggctgaaaca gcaagaactg cttcggcagg caatgcggaa tatcaatccc agcacagcaa 1081 attctccaaa atgtcaggag ttagccctgc gtagccagtt accaacactg gagcaggatg 1141 gtgggactca aaatccagtg tcttctcccg ggatgtctca ggaattgaga acaatgacga 1201 ccaatagctc agatcctttc cttaacagtg gcacctatca ctctcgagat gagagtacag 1261 acagtggact aagcatgagc agcTACAGTG TCCCTCGAAC CCCAGATGAC TTCCTGAACA 1321 GTGTGGATGA GATGGATACA GGTGATACTA TCAACCAAAG CACCCTGCCC TCACAGCAGA 1381 ACCGTTTCCC AGACTACCTT GAAGCCATTC CTGGGACAAA TGTGGACCTT GGAACACTGG 1441 AAGGAGATGG AATGAACATA GAAGGAGAGG AGCTGATGCC AAGTCTGCAG GAAGCTTTGA 1501 GTTCTGACAT CCTTAATGAC ATGGAGTCTG TTTTGGCTGC CACCAAGCTA GATAACGAAA 1561 GCTTTCTTAC ATGGCTATAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1621 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1681 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAACATGTT CCTATACTGT 1741 TACCAATACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt