Transcript: Mouse XM_006509874.3

PREDICTED: Mus musculus contactin 5 (Cntn5), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cntn5 (244682)
Length:
2821
CDS:
738..2735

Additional Resources:

NCBI RefSeq record:
XM_006509874.3
NBCI Gene record:
Cntn5 (244682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242057 CTGGATGATGCCGGAATATAC pLKO_005 1815 CDS 100% 13.200 18.480 N Cntn5 n/a
2 TRCN0000242054 AGGATAGAGCTTACTCCTAAA pLKO_005 2538 CDS 100% 10.800 8.640 N Cntn5 n/a
3 TRCN0000242056 CAAGGCAGTGAGGGCGAATAA pLKO_005 2291 CDS 100% 13.200 9.240 N Cntn5 n/a
4 TRCN0000242058 GGCAACCCATCTCCTAGTTAC pLKO_005 1113 CDS 100% 10.800 7.560 N Cntn5 n/a
5 TRCN0000242055 GTAAGTCCAGACTGCGGAAAT pLKO_005 1762 CDS 100% 10.800 7.560 N Cntn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12027 pDONR223 100% 30.9% 31.7% None (many diffs) n/a
2 ccsbBroad304_12027 pLX_304 0% 30.9% 31.7% V5 (many diffs) n/a
3 TRCN0000477911 ACCGGAATCGACCATTCGATAGGA pLX_317 18.7% 30.9% 31.7% V5 (many diffs) n/a
Download CSV