Transcript: Mouse XM_006509952.1

PREDICTED: Mus musculus amyloid beta (A4) precursor-like protein 2 (Aplp2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aplp2 (11804)
Length:
3515
CDS:
69..2201

Additional Resources:

NCBI RefSeq record:
XM_006509952.1
NBCI Gene record:
Aplp2 (11804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509952.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080049 CGAGCGGATATGGACCAATTT pLKO.1 1614 CDS 100% 13.200 18.480 N Aplp2 n/a
2 TRCN0000080050 GAGCGGATATGGACCAATTTA pLKO.1 1615 CDS 100% 15.000 10.500 N Aplp2 n/a
3 TRCN0000006701 CCAATGATGTTGATGTGTATT pLKO.1 1021 CDS 100% 13.200 9.240 N APLP2 n/a
4 TRCN0000080052 CCTGCATACCATTCGTCATTA pLKO.1 1421 CDS 100% 13.200 9.240 N Aplp2 n/a
5 TRCN0000006703 CCTGGAGCAGATGCAGATTTA pLKO.1 2180 CDS 100% 13.200 9.240 N APLP2 n/a
6 TRCN0000315225 CCTGGAGCAGATGCAGATTTA pLKO_005 2180 CDS 100% 13.200 9.240 N APLP2 n/a
7 TRCN0000080048 CCTGGATTGTTAAGACTATAA pLKO.1 2321 3UTR 100% 13.200 9.240 N Aplp2 n/a
8 TRCN0000080051 GTGAACATTCAGACTGGCAAA pLKO.1 96 CDS 100% 4.050 2.835 N Aplp2 n/a
9 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 565 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509952.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.