Transcript: Mouse XM_006509968.1

PREDICTED: Mus musculus cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) (Cdkn2d), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdkn2d (12581)
Length:
1212
CDS:
198..698

Additional Resources:

NCBI RefSeq record:
XM_006509968.1
NBCI Gene record:
Cdkn2d (12581)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085091 TGGCGATAAGAGAGGGCCATA pLKO.1 535 CDS 100% 4.050 5.670 N Cdkn2d n/a
2 TRCN0000085088 GCCATCTAAACGGTTCAGTTT pLKO.1 918 3UTR 100% 4.950 3.960 N Cdkn2d n/a
3 TRCN0000085090 GCTCAGAACCTCATGGACATT pLKO.1 648 CDS 100% 4.950 3.465 N Cdkn2d n/a
4 TRCN0000085089 TCAGCTTCCTAGCTCCTGAAT pLKO.1 565 CDS 100% 4.950 3.465 N Cdkn2d n/a
5 TRCN0000434521 ACATGATGATCCCAATGTGAC pLKO_005 679 CDS 100% 4.050 2.835 N Cdkn2d n/a
6 TRCN0000085092 CGCCCTGAACCGCTTTGGCAA pLKO.1 305 CDS 100% 0.000 0.000 N Cdkn2d n/a
7 TRCN0000428135 AGGAGCAGTTTGTGGTTTATT pLKO_005 796 3UTR 100% 15.000 9.000 N Cdkn2d n/a
8 TRCN0000425216 AGCATGGTGCTGATGTCAATG pLKO_005 481 CDS 100% 10.800 6.480 N Cdkn2d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00284 pDONR223 100% 82.1% 86.7% None (many diffs) n/a
2 ccsbBroad304_00284 pLX_304 0% 82.1% 86.7% V5 (many diffs) n/a
3 TRCN0000468501 CGTCATAAGTGGAAGGGTTTCTGT pLX_317 83% 82.1% 86.7% V5 (many diffs) n/a
Download CSV