Transcript: Mouse XM_006510172.2

PREDICTED: Mus musculus solute carrier family 36 (proton/amino acid symporter), member 4 (Slc36a4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc36a4 (234967)
Length:
5564
CDS:
428..1534

Additional Resources:

NCBI RefSeq record:
XM_006510172.2
NBCI Gene record:
Slc36a4 (234967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068414 CGCGAGCTGAAGAATCTCTTT pLKO.1 701 CDS 100% 4.950 3.465 N Slc36a4 n/a
2 TRCN0000068413 GCCCTTAATAAACGAGCAGAA pLKO.1 123 5UTR 100% 4.050 2.835 N Slc36a4 n/a
3 TRCN0000068415 CCTAGCCACTTTAGGCTACAT pLKO.1 982 CDS 100% 0.495 0.347 N Slc36a4 n/a
4 TRCN0000068416 CCTTTCTGAATGTGAACTCTA pLKO.1 1491 CDS 100% 4.950 2.970 N Slc36a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09464 pDONR223 100% 61.1% 64.6% None (many diffs) n/a
2 ccsbBroad304_09464 pLX_304 0% 61.1% 64.6% V5 (many diffs) n/a
3 TRCN0000467203 ACGATTAAAGCTCTTAACATGTAT pLX_317 17.3% 61.1% 64.6% V5 (many diffs) n/a
Download CSV