Transcript: Mouse XM_006510191.3

PREDICTED: Mus musculus septin 7 (Sept7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sept7 (235072)
Length:
2721
CDS:
549..1703

Additional Resources:

NCBI RefSeq record:
XM_006510191.3
NBCI Gene record:
Sept7 (235072)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322561 GAGGATAAATTGCCATAATAT pLKO_005 2064 3UTR 100% 15.000 10.500 N SEPTIN7 n/a
2 TRCN0000101848 CCTTCAGGACATGGACTTAAA pLKO.1 888 CDS 100% 13.200 9.240 N Sept7 n/a
3 TRCN0000349184 CCTTCAGGACATGGACTTAAA pLKO_005 888 CDS 100% 13.200 9.240 N Sept7 n/a
4 TRCN0000101845 GCCTTGAATTGTCTAGGATAT pLKO.1 1864 3UTR 100% 10.800 7.560 N Sept7 n/a
5 TRCN0000349183 GCCTTGAATTGTCTAGGATAT pLKO_005 1864 3UTR 100% 10.800 7.560 N Sept7 n/a
6 TRCN0000101849 CCAGAGGAATGCCAACAGTTT pLKO.1 990 CDS 100% 4.950 3.465 N Sept7 n/a
7 TRCN0000316367 CCAGAGGAATGCCAACAGTTT pLKO_005 990 CDS 100% 4.950 3.465 N Sept7 n/a
8 TRCN0000101847 CGTCGTCAGTTTGAAGAAGAA pLKO.1 1590 CDS 100% 4.950 3.465 N Sept7 n/a
9 TRCN0000316366 CGTCGTCAGTTTGAAGAAGAA pLKO_005 1590 CDS 100% 4.950 3.465 N Sept7 n/a
10 TRCN0000180810 GCAGCCTGTTATCGACTACAT pLKO.1 770 CDS 100% 4.950 3.465 N SEPTIN7 n/a
11 TRCN0000101846 GCAGTGTTGTTTATACTTCAT pLKO.1 863 CDS 100% 4.950 3.465 N Sept7 n/a
12 TRCN0000316368 GCAGTGTTGTTTATACTTCAT pLKO_005 863 CDS 100% 4.950 3.465 N Sept7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10722 pDONR223 100% 87.6% 91.6% None (many diffs) n/a
2 ccsbBroad304_10722 pLX_304 0% 87.6% 91.6% V5 (many diffs) n/a
3 TRCN0000468514 CATTGAAAAGGAATCTTACTCCCC pLX_317 24.9% 87.6% 91.6% V5 (many diffs) n/a
Download CSV