Transcript: Mouse XM_006510556.3

PREDICTED: Mus musculus endonuclease/exonuclease/phosphatase family domain containing 1 (Eepd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eepd1 (67484)
Length:
1710
CDS:
535..1467

Additional Resources:

NCBI RefSeq record:
XM_006510556.3
NBCI Gene record:
Eepd1 (67484)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092802 GCATCGTGGAATACCGAGAAT pLKO.1 722 CDS 100% 4.950 6.930 N Eepd1 n/a
2 TRCN0000305612 GAATCAGGAGCGGCTAAATAT pLKO_005 639 CDS 100% 15.000 12.000 N Eepd1 n/a
3 TRCN0000092799 CCTGTCACATAACCGCAAGTT pLKO.1 585 CDS 100% 4.950 3.465 N Eepd1 n/a
4 TRCN0000323775 CCTGTCACATAACCGCAAGTT pLKO_005 585 CDS 100% 4.950 3.465 N Eepd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09051 pDONR223 100% 46.5% 50.6% None (many diffs) n/a
2 ccsbBroad304_09051 pLX_304 0% 46.5% 50.6% V5 (many diffs) n/a
3 TRCN0000477234 CGGCGCACTATTAAAGCTTTATCG pLX_317 19.6% 46.5% 50.6% V5 (many diffs) n/a
Download CSV