Transcript: Mouse XM_006510581.3

PREDICTED: Mus musculus anillin, actin binding protein (Anln), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Anln (68743)
Length:
5109
CDS:
649..4068

Additional Resources:

NCBI RefSeq record:
XM_006510581.3
NBCI Gene record:
Anln (68743)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090265 CCGCTTGTTTATCCAAATCTT pLKO.1 1337 CDS 100% 5.625 7.875 N Anln n/a
2 TRCN0000309797 CCGCTTGTTTATCCAAATCTT pLKO_005 1337 CDS 100% 5.625 7.875 N Anln n/a
3 TRCN0000090267 CGCAACACTCTGGAATTGATT pLKO.1 3850 CDS 100% 5.625 3.938 N Anln n/a
4 TRCN0000309725 CGCAACACTCTGGAATTGATT pLKO_005 3850 CDS 100% 5.625 3.938 N Anln n/a
5 TRCN0000090266 GCCTAGAGAATGTAATTTCTT pLKO.1 2495 CDS 100% 5.625 3.938 N Anln n/a
6 TRCN0000090264 GCAGCCTTCATTCTTCAGTTA pLKO.1 3392 CDS 100% 4.950 3.465 N Anln n/a
7 TRCN0000309796 GCAGCCTTCATTCTTCAGTTA pLKO_005 3392 CDS 100% 4.950 3.465 N Anln n/a
8 TRCN0000090263 GCAGGTTGTATTCTATGCTTT pLKO.1 4144 3UTR 100% 4.950 3.465 N Anln n/a
9 TRCN0000331985 GCAGGTTGTATTCTATGCTTT pLKO_005 4144 3UTR 100% 4.950 3.465 N Anln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12039 pDONR223 100% 31% 31.8% None (many diffs) n/a
2 ccsbBroad304_12039 pLX_304 0% 31% 31.8% V5 (many diffs) n/a
3 TRCN0000465225 GTCGCAGCGTATTGCCTGGATTGT pLX_317 20.8% 31% 31.8% V5 (many diffs) n/a
Download CSV