Transcript: Mouse XM_006510603.2

PREDICTED: Mus musculus CXADR-like membrane protein (Clmp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clmp (71566)
Length:
4111
CDS:
50..1168

Additional Resources:

NCBI RefSeq record:
XM_006510603.2
NBCI Gene record:
Clmp (71566)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319626 AGCCGTCATGTCTACAATAAC pLKO_005 245 CDS 100% 13.200 18.480 N Clmp n/a
2 TRCN0000137941 GCTCACCGATAATGAAGGGAA pLKO.1 199 CDS 100% 2.640 3.696 N CLMP n/a
3 TRCN0000350026 GAATGGCTGCTCACCGATAAT pLKO_005 191 CDS 100% 13.200 10.560 N Clmp n/a
4 TRCN0000125330 CCAGCCGTCATGTCTACAATA pLKO.1 243 CDS 100% 13.200 9.240 N Clmp n/a
5 TRCN0000319557 TCCTGATATGGCTGCTAATAC pLKO_005 792 CDS 100% 13.200 9.240 N Clmp n/a
6 TRCN0000125331 CCACCCAAATCCAGAATTGAT pLKO.1 581 CDS 100% 5.625 3.938 N Clmp n/a
7 TRCN0000317747 CCACCCAAATCCAGAATTGAT pLKO_005 581 CDS 100% 5.625 3.938 N Clmp n/a
8 TRCN0000125332 CGAGGAAGAAGACAGACCTAA pLKO.1 835 CDS 100% 4.950 3.465 N Clmp n/a
9 TRCN0000125333 CTGCCACCCAAATCCAGAATT pLKO.1 578 CDS 100% 0.000 0.000 N Clmp n/a
10 TRCN0000125329 GCTGGATGTTTCTAGGAGAAA pLKO.1 1994 3UTR 100% 4.950 2.970 N Clmp n/a
11 TRCN0000317668 GCTGGATGTTTCTAGGAGAAA pLKO_005 1994 3UTR 100% 4.950 2.970 N Clmp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04133 pDONR223 100% 86.1% 90.9% None (many diffs) n/a
2 ccsbBroad304_04133 pLX_304 0% 86.1% 90.9% V5 (many diffs) n/a
3 TRCN0000481097 CCCGGCCGCTCGAGCCAGGATCTA pLX_317 46% 86.1% 90.9% V5 (many diffs) n/a
Download CSV