Transcript: Mouse XM_006510636.3

PREDICTED: Mus musculus ubiquitin associated and SH3 domain containing, B (Ubash3b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubash3b (72828)
Length:
3277
CDS:
156..2003

Additional Resources:

NCBI RefSeq record:
XM_006510636.3
NBCI Gene record:
Ubash3b (72828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510636.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099665 GCTCAGAATCATTTAGCATAT pLKO.1 2099 3UTR 100% 10.800 15.120 N Ubash3b n/a
2 TRCN0000099667 CCATCCTAAATACCGTATCAT pLKO.1 1042 CDS 100% 5.625 7.875 N Ubash3b n/a
3 TRCN0000099666 CCTGCGAAGAATTGGGAGAAA pLKO.1 1888 CDS 100% 4.950 3.465 N Ubash3b n/a
4 TRCN0000099668 CCACCATATTCTCTCGGGATA pLKO.1 784 CDS 100% 4.050 2.835 N Ubash3b n/a
5 TRCN0000099669 GCGTTCAGACTGCACATAATA pLKO.1 1474 CDS 100% 15.000 9.000 N Ubash3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510636.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04453 pDONR223 100% 84% 90% None (many diffs) n/a
2 ccsbBroad304_04453 pLX_304 0% 84% 90% V5 (many diffs) n/a
3 TRCN0000467371 CGTGAAGCTTCAAACGTCTTAAGC pLX_317 19.5% 84% 90% V5 (many diffs) n/a
Download CSV