Construct: ORF TRCN0000467371
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001911.1_s317c1
- Derived from:
- ccsbBroadEn_04453
- DNA Barcode:
- CGTGAAGCTTCAAACGTCTTAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UBASH3B (84959)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467371
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84959 | UBASH3B | ubiquitin associated and SH... | NM_032873.5 | 100% | 100% | |
| 2 | human | 84959 | UBASH3B | ubiquitin associated and SH... | NM_001363365.2 | 94.2% | 89.3% | 0_1ins109;105_108delTGGT |
| 3 | human | 84959 | UBASH3B | ubiquitin associated and SH... | XM_011543041.2 | 93.8% | 87.4% | (many diffs) |
| 4 | human | 84959 | UBASH3B | ubiquitin associated and SH... | XM_005271712.3 | 91.3% | 88.8% | (many diffs) |
| 5 | mouse | 72828 | Ubash3b | ubiquitin associated and SH... | NM_176860.5 | 87.6% | 95.9% | (many diffs) |
| 6 | mouse | 72828 | Ubash3b | ubiquitin associated and SH... | XM_006510636.3 | 84% | 90% | (many diffs) |
| 7 | mouse | 72828 | Ubash3b | ubiquitin associated and SH... | XM_006510634.3 | 83.4% | 87.9% | (many diffs) |
| 8 | mouse | 72828 | Ubash3b | ubiquitin associated and SH... | XM_006510632.2 | 74.1% | 74.4% | (many diffs) |
| 9 | mouse | 72828 | Ubash3b | ubiquitin associated and SH... | XM_006510637.3 | 70.8% | 77.6% | (many diffs) |
| 10 | mouse | 72828 | Ubash3b | ubiquitin associated and SH... | XM_017313612.1 | 70.8% | 77.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2013
- ORF length:
- 1947
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tcagtacggc caccccagtc cgctcggcat ggctgcgaga gaggagctgt 121 acagcaaagt caccccccgg aggaaccgcc aacagcgccc cggcaccatc aagcatggat 181 cggcgctgga cgtgctcctc tccatggggt tccccagagc ccgcgcacaa aaagccttgg 241 catccacggg aggaagaagt gttcaggcag catgtgactg gttattctcc catgtcggtg 301 accccttcct ggatgacccc ctgccccggg agtacgtcct ctacctccgt cccaccggcc 361 ccttagcaca gaagctttcc gacttttggc agcagtcgaa gcagatctgc gggaagaaca 421 aggcacacaa catcttcccc cacatcacac tctgccagtt ctttatgtgc gaggacagca 481 aggtggatgc cctgggggaa gccctgcaga ccacggtcag tcgctggaaa tgtaagttct 541 cggccccgct gcccctggag ctctatacgt cgtccaactt catcggcctc tttgtaaagg 601 aagacagtgc ggaggtcctc aagaagtttg ctgctgactt tgctgcagag gctgcatcca 661 aaaccgaagt gcatgtggaa cctcataaga agcagctaca tgtgaccctg gcttaccact 721 tccaagccag ccacctaccc accctagaga aactggccca gaacattgac gtcaagctag 781 ggtgtgactg ggtggctacc atattttctc gggatatccg atttgctaac catgagacat 841 tacaggtcat ctacccctat accccacaaa atgacgatga gctggagctg gtccccgggg 901 acttcatctt catgtctcca atggagcaga ccagcaccag cgagggttgg atctatggca 961 cgtccttaac caccggctgc tctggactcc tgcctgagaa ttacattacc aaggctgatg 1021 aatgcagcac ctggatattt catggttctt attcaatctt aaatacatcg tcatccaact 1081 ctctcacgtt tggggatgga gtattggaga ggcggcctta tgaggaccag gggctcgggg 1141 agacgactcc tcttactatc atctgccagc ccatgcagcc gctgagggtc aacagccagc 1201 ccggccccca gaagcgatgc ctttttgtgt gtcggcatgg tgagaggatg gatgttgtgt 1261 ttgggaagta ctggctgtcc cagtgcttcg atgccaaagg ccgctacata cgcaccaacc 1321 tgaacatgcc tcatagttta cctcagcgga gtggtggttt ccgagattac gagaaagatg 1381 ctcccatcac tgtgtttgga tgcatgcaag caagactagt gggtgaagcc ttattagaga 1441 gcaataccat tatcgatcat gtctattgct ccccgtccct tcgctgcgtt cagactgcac 1501 acaatatctt gaaaggttta caacaagaaa atcacttgaa gatccgtgta gagcccggct 1561 tatttgagtg gacaaaatgg gttgctggga gcacattacc tgcatggata cctccatcag 1621 agttagctgc agccaaccTG AGTGTTGATA CAACCTACAG ACCTCACATT CCAATCAGCA 1681 AATTAGTTGT TTCAGAATCC TATGATACTT ATATCAGTAG AAGTTTCCAA GTAACAAAAG 1741 AAATAATAAG TGAATGTAAA AGTAAAGGAA ATAACATCCT GATTGTGGCC CACGCATCTT 1801 CCCTTGAAGC GTGTACCTGC CAACTTCAGG GCCTGTCACC TCAGAACTCC AAGGACTTCG 1861 TACAAATGGT CCGAAAGATC CCATATCTGG GATTTTGTTC CTGTGAAGAA TTAGGAGAAA 1921 CTGGAATATG GCAGCTGACA GATCCACCAA TCCTTCCTCT TACCCATGGA CCAACTGGGG 1981 GCTTCAACTG GAGAGAGACC TTGCTTCAAG AATACCCAAC TTTCTTGTAC AAAGTGGTTG 2041 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 2101 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACG 2161 TGAAGCTTCA AACGTCTTAA GCACGCGTTA AGTCgacaat caacctctgg attacaaaat 2221 ttgtgaaaga tt