Transcript: Mouse XM_006510660.3

PREDICTED: Mus musculus RIKEN cDNA 4930550C14 gene (4930550C14Rik), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4930550C14Rik (75311)
Length:
2856
CDS:
481..993

Additional Resources:

NCBI RefSeq record:
XM_006510660.3
NBCI Gene record:
4930550C14Rik (75311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215317 CTCAACTTTGATGAGTATATT pLKO.1 763 CDS 100% 15.000 21.000 N 4930550C14Rik n/a
2 TRCN0000264586 CTCAACTTTGATGAGTATATT pLKO_005 763 CDS 100% 15.000 21.000 N 4930550C14Rik n/a
3 TRCN0000264585 TAATGAGACTTTAGGTCTAAT pLKO_005 642 CDS 100% 13.200 18.480 N 4930550C14Rik n/a
4 TRCN0000264584 CCTACCTTCAAGCCCACTTTC pLKO_005 1025 3UTR 100% 10.800 15.120 N 4930550C14Rik n/a
5 TRCN0000217730 GATGTCAAGCTTCAGCGAATA pLKO.1 832 CDS 100% 10.800 7.560 N 4930550C14Rik n/a
6 TRCN0000201730 GCGAAAGCCAAGAAACTACTT pLKO.1 1048 3UTR 100% 4.950 3.465 N 4930550C14Rik n/a
7 TRCN0000264587 GCAACTCTTCAGCTAACTTAA pLKO_005 809 CDS 100% 13.200 7.920 N 4930550C14Rik n/a
8 TRCN0000192073 CGAAAGCCAAGAAACTACTTA pLKO.1 1049 3UTR 100% 5.625 3.375 N 4930550C14Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.