Transcript: Mouse XM_006510755.1

PREDICTED: Mus musculus Bardet-Biedl syndrome 4 (human) (Bbs4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bbs4 (102774)
Length:
2333
CDS:
71..1450

Additional Resources:

NCBI RefSeq record:
XM_006510755.1
NBCI Gene record:
Bbs4 (102774)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250504 CTGGATAAGTGTAACCCTTTA pLKO_005 986 CDS 100% 10.800 15.120 N Bbs4 n/a
2 TRCN0000250501 TGGAATGAATCCAGCTATATT pLKO_005 1943 3UTR 100% 15.000 10.500 N Bbs4 n/a
3 TRCN0000250503 CTGATCCATCTCCACTATATC pLKO_005 182 CDS 100% 13.200 9.240 N Bbs4 n/a
4 TRCN0000250502 TCTGGACCAAACCAGTCAAAG pLKO_005 1191 CDS 100% 10.800 7.560 N Bbs4 n/a
5 TRCN0000183388 GCTATGTGAATATGCTATCTA pLKO.1 262 CDS 100% 5.625 3.938 N Bbs4 n/a
6 TRCN0000006723 CCTGGATAAGTGTAACCCTTT pLKO.1 985 CDS 100% 4.050 2.835 N BBS4 n/a
7 TRCN0000184504 GCTGTGGTAATGAAGCCTCAT pLKO.1 1796 3UTR 100% 4.050 2.835 N Bbs4 n/a
8 TRCN0000184666 GCAAACGATGAAAGCCCGTAA pLKO.1 1723 3UTR 100% 4.050 2.835 N Bbs4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05878 pDONR223 100% 78.2% 78.5% None (many diffs) n/a
2 ccsbBroad304_05878 pLX_304 0% 78.2% 78.5% V5 (many diffs) n/a
3 TRCN0000468273 GAGCCCACTTCAGATTCCTACTGT pLX_317 28% 78.2% 78.5% V5 (many diffs) n/a
Download CSV