Transcript: Mouse XM_006510780.3

PREDICTED: Mus musculus RAB27A, member RAS oncogene family (Rab27a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab27a (11891)
Length:
3395
CDS:
563..1228

Additional Resources:

NCBI RefSeq record:
XM_006510780.3
NBCI Gene record:
Rab27a (11891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381753 CAAACATAAGCCACGCGATTG pLKO_005 1065 CDS 100% 6.000 8.400 N Rab27a n/a
2 TRCN0000100578 CCAGTACACTGATGGCAAGTT pLKO.1 643 CDS 100% 4.950 6.930 N Rab27a n/a
3 TRCN0000100577 GCTTCTGTTCGACCTGACAAA pLKO.1 850 CDS 100% 4.950 6.930 N Rab27a n/a
4 TRCN0000379740 AGGAGAGGTTTCGTAGCTTAA pLKO_005 795 CDS 100% 10.800 8.640 N Rab27a n/a
5 TRCN0000100575 GCCAGTTTAAGAGAAGTGTTT pLKO.1 2261 3UTR 100% 4.950 3.960 N Rab27a n/a
6 TRCN0000100576 CGAAACTGGATAAGCCAGCTA pLKO.1 893 CDS 100% 2.640 2.112 N Rab27a n/a
7 TRCN0000100579 GACAAACATAAGCCACGCGAT pLKO.1 1063 CDS 100% 2.160 1.728 N Rab27a n/a
8 TRCN0000382082 AGTCTCATTGAAGACATTAAG pLKO_005 1593 3UTR 100% 13.200 9.240 N Rab27a n/a
9 TRCN0000381034 TCACTCTCAAACACGTGAATG pLKO_005 1681 3UTR 100% 10.800 7.560 N Rab27a n/a
10 TRCN0000381368 ATGCTCCTGGACCTGATCATG pLKO_005 1088 CDS 100% 4.950 3.465 N Rab27a n/a
11 TRCN0000005298 CAGGAGAGGTTTCGTAGCTTA pLKO.1 794 CDS 100% 4.950 3.465 N RAB27A n/a
12 TRCN0000297751 CAGGAGAGGTTTCGTAGCTTA pLKO_005 794 CDS 100% 4.950 3.465 N RAB27A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01361 pDONR223 100% 88% 95.9% None (many diffs) n/a
2 ccsbBroad304_01361 pLX_304 0% 88% 95.9% V5 (many diffs) n/a
3 TRCN0000469786 TTTAGGCAAAAAATAACACCATGA pLX_317 56.1% 88% 95.9% V5 (many diffs) n/a
Download CSV