Transcript: Mouse XM_006510840.2

PREDICTED: Mus musculus non-catalytic region of tyrosine kinase adaptor protein 1 (Nck1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nck1 (17973)
Length:
1722
CDS:
100..1233

Additional Resources:

NCBI RefSeq record:
XM_006510840.2
NBCI Gene record:
Nck1 (17973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122933 GCGAGTTCGAAATTCCATGAA pLKO.1 216 CDS 100% 4.950 6.930 N NCK1 n/a
2 TRCN0000023695 CCGATCTTTACAAGTGAGCAA pLKO.1 1177 CDS 100% 2.640 3.696 N Nck1 n/a
3 TRCN0000337633 TAACTCAGCCCATACGTATAT pLKO_005 1379 3UTR 100% 13.200 10.560 N Nck1 n/a
4 TRCN0000023697 GCATTAAATGAAAGAGGGCAT pLKO.1 982 CDS 100% 2.160 1.728 N Nck1 n/a
5 TRCN0000362659 AGGCGATGTAATGGATGTTAT pLKO_005 738 CDS 100% 13.200 9.240 N Nck1 n/a
6 TRCN0000337636 CCTGGTGGCGAGTTCGAAATT pLKO_005 209 CDS 100% 13.200 9.240 N Nck1 n/a
7 TRCN0000337705 CTGGCAATCCTTGGTATTATG pLKO_005 932 CDS 100% 13.200 9.240 N Nck1 n/a
8 TRCN0000023694 GCAGTTGTCAATAACCTAAAT pLKO.1 640 CDS 100% 13.200 9.240 N Nck1 n/a
9 TRCN0000337703 TCAAGAAGAATGAGCGATTAT pLKO_005 167 CDS 100% 13.200 9.240 N Nck1 n/a
10 TRCN0000362658 TGATTTCTCAGTATCACTAAA pLKO_005 1044 CDS 100% 13.200 9.240 N Nck1 n/a
11 TRCN0000337634 TGGCAGCTACAACGGACAAAT pLKO_005 534 CDS 100% 13.200 9.240 N Nck1 n/a
12 TRCN0000023698 GCTGATGATAGCTTTGTTGAT pLKO.1 376 CDS 100% 4.950 3.465 N Nck1 n/a
13 TRCN0000362657 AGTGCTGTTTCTAACTATATG pLKO_005 1325 3UTR 100% 13.200 7.920 N Nck1 n/a
14 TRCN0000023696 CCTTCAAACTATGTAACTGAA pLKO.1 565 CDS 100% 4.950 2.475 Y Nck1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01062 pDONR223 100% 92.8% 98.9% None (many diffs) n/a
2 ccsbBroad304_01062 pLX_304 0% 92.8% 98.9% V5 (many diffs) n/a
3 TRCN0000473644 TTCCAACATACCTGCAGATCGAAA pLX_317 6.5% 92.8% 98.9% V5 (many diffs) n/a
Download CSV