Transcript: Mouse XM_006510888.3

PREDICTED: Mus musculus sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (Sema7a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema7a (20361)
Length:
2188
CDS:
384..1904

Additional Resources:

NCBI RefSeq record:
XM_006510888.3
NBCI Gene record:
Sema7a (20361)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415138 GTGAACATCGGCTCCACAAAG pLKO_005 231 5UTR 100% 10.800 15.120 N Sema7a n/a
2 TRCN0000439377 ACTCAGCTGTCTGCGTGTATT pLKO_005 895 CDS 100% 13.200 10.560 N Sema7a n/a
3 TRCN0000415048 CTAAGTACCATTACCAGAAAG pLKO_005 1114 CDS 100% 10.800 8.640 N Sema7a n/a
4 TRCN0000067542 CCTAGCTGCATCCTGTTCATT pLKO.1 1683 CDS 100% 5.625 4.500 N Sema7a n/a
5 TRCN0000067539 CCATAGCTTTGTCTTCAATAT pLKO.1 1241 CDS 100% 13.200 9.240 N Sema7a n/a
6 TRCN0000446411 GCCATCCAGGCTATATCATTG pLKO_005 1293 CDS 100% 10.800 7.560 N Sema7a n/a
7 TRCN0000067541 CCAAGCCTATGATGATAAGAT pLKO.1 602 CDS 100% 5.625 3.938 N Sema7a n/a
8 TRCN0000067540 GCAGGAATACAACGGGAAGAT pLKO.1 482 CDS 100% 4.950 3.465 N Sema7a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01937 pDONR223 100% 66.6% 69% None (many diffs) n/a
2 ccsbBroad304_01937 pLX_304 0% 66.6% 69% V5 (many diffs) n/a
3 TRCN0000476524 GAATCGGAGGCCGCTCTTATATCA pLX_317 15.7% 66.6% 69% V5 (many diffs) n/a
Download CSV