Transcript: Mouse XM_006510907.3

PREDICTED: Mus musculus thrombospondin, type I, domain containing 4 (Thsd4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Thsd4 (207596)
Length:
8677
CDS:
156..3212

Additional Resources:

NCBI RefSeq record:
XM_006510907.3
NBCI Gene record:
Thsd4 (207596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092441 CTACAACAACAAGCCATTCAT pLKO.1 1115 CDS 100% 5.625 3.938 N Gm1118 n/a
2 TRCN0000092442 AGCCTTCCACTGAACACAGAA pLKO.1 235 CDS 100% 4.950 3.465 N Gm1118 n/a
3 TRCN0000080439 CCTCTGTGTCTACAACTACTA pLKO.1 3122 CDS 100% 4.950 3.465 N Thsd4 n/a
4 TRCN0000080442 CCTGGGATCTGACAAAGTCTT pLKO.1 1328 CDS 100% 4.950 3.465 N Thsd4 n/a
5 TRCN0000080438 CGCCAGTTAAACCAGCAAGAT pLKO.1 4266 3UTR 100% 4.950 3.465 N Thsd4 n/a
6 TRCN0000118215 CTGTGTCTACAACTACTACAA pLKO.1 3125 CDS 100% 4.950 3.465 N THSD4 n/a
7 TRCN0000092439 GCATCTGCGATCAACAGCAAT pLKO.1 1001 CDS 100% 4.950 3.465 N Gm1118 n/a
8 TRCN0000080440 CCCACTAATGAGATCCTGGAT pLKO.1 1662 CDS 100% 2.640 1.848 N Thsd4 n/a
9 TRCN0000080441 GCTAAATGGTTTAGCACAGAA pLKO.1 2895 CDS 100% 0.495 0.347 N Thsd4 n/a
10 TRCN0000092440 TCTGCTTCTAAGCAGGGCTAT pLKO.1 768 CDS 100% 0.405 0.284 N Gm1118 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6941 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12639 pDONR223 100% 42% 44.1% None (many diffs) n/a
2 ccsbBroad304_12639 pLX_304 0% 42% 44.1% V5 (many diffs) n/a
3 TRCN0000465313 GCCTACCTGTGCTGAACTGAAAGG pLX_317 23.8% 42% 44.1% V5 (many diffs) n/a
Download CSV