Transcript: Mouse XM_006510935.3

PREDICTED: Mus musculus myosin VC (Myo5c), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myo5c (208943)
Length:
5804
CDS:
243..5492

Additional Resources:

NCBI RefSeq record:
XM_006510935.3
NBCI Gene record:
Myo5c (208943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251299 GATGTGGCCATACGGATTTAT pLKO_005 4734 CDS 100% 15.000 21.000 N Myo5c n/a
2 TRCN0000251302 ACAACCTCCAGCCGATAATAG pLKO_005 4780 CDS 100% 13.200 18.480 N Myo5c n/a
3 TRCN0000251300 AGTTTAACCTGCACGTCTTTA pLKO_005 1627 CDS 100% 13.200 18.480 N Myo5c n/a
4 TRCN0000251301 CCAGATCATTGGCGCCAATAT pLKO_005 932 CDS 100% 13.200 9.240 N Myo5c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12290 pDONR223 100% 21.3% 23% None (many diffs) n/a
2 ccsbBroad304_12290 pLX_304 0% 21.3% 23% V5 (many diffs) n/a
3 TRCN0000475184 GATTGAAATTTTCATGTTTAGAGT pLX_317 32.3% 21.3% 23% V5 (many diffs) n/a
Download CSV