Transcript: Mouse XM_006510980.3

PREDICTED: Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant X21, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfdp2 (211586)
Length:
7351
CDS:
672..1676

Additional Resources:

NCBI RefSeq record:
XM_006510980.3
NBCI Gene record:
Tfdp2 (211586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095783 GAACATTAGACGAAGAGTTTA pLKO.1 869 CDS 100% 13.200 18.480 N Tfdp2 n/a
2 TRCN0000413300 GAGGCGGATAGAACGGATAAA pLKO_005 1010 CDS 100% 13.200 18.480 N TFDP2 n/a
3 TRCN0000095780 CCCTGTTCATTCAACGATGAA pLKO.1 1614 CDS 100% 0.495 0.693 N Tfdp2 n/a
4 TRCN0000095782 CCACAGGACCTTCTTGGTTAA pLKO.1 1393 CDS 100% 10.800 7.560 N Tfdp2 n/a
5 TRCN0000019920 CGAAGAGTTTATGATGCTTTA pLKO.1 879 CDS 100% 10.800 7.560 N TFDP2 n/a
6 TRCN0000420624 GAACTCTACCCAATCAGTTTC pLKO_005 1430 CDS 100% 10.800 7.560 N TFDP2 n/a
7 TRCN0000095779 GCTGAGATGATTGAACTGAAA pLKO.1 1829 3UTR 100% 4.950 3.465 N Tfdp2 n/a
8 TRCN0000095781 CCTACCAATTCTGCTCAGGAA pLKO.1 963 CDS 100% 2.640 1.848 N Tfdp2 n/a
9 TRCN0000092881 GAGGAAGATGAAGAGGAGGAA pLKO.1 1638 CDS 100% 2.640 1.320 Y Gm4169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01662 pDONR223 100% 79.6% 82.6% None (many diffs) n/a
2 ccsbBroad304_01662 pLX_304 0% 79.6% 82.6% V5 (many diffs) n/a
3 TRCN0000473496 ATCACGGCATTTAAGGAGTGGGGT pLX_317 45.4% 79.6% 82.6% V5 (many diffs) n/a
Download CSV