Transcript: Mouse XM_006510994.3

PREDICTED: Mus musculus transcription factor 12 (Tcf12), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcf12 (21406)
Length:
4652
CDS:
233..2353

Additional Resources:

NCBI RefSeq record:
XM_006510994.3
NBCI Gene record:
Tcf12 (21406)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235845 CCATCCCATAATGCATCAATT pLKO_005 1616 CDS 100% 13.200 18.480 N Tcf12 n/a
2 TRCN0000235848 TGACGATTTCAACCGTGAATC pLKO_005 835 CDS 100% 10.800 15.120 N Tcf12 n/a
3 TRCN0000015170 CCACCTGTTAATAGTGGGAAA pLKO.1 317 CDS 100% 4.050 5.670 N TCF12 n/a
4 TRCN0000075504 GCCTTGTTACAAATAGTCGAT pLKO.1 1668 CDS 100% 2.640 3.696 N Tcf12 n/a
5 TRCN0000075503 GCCAGCATTGTTAAAGCTGTT pLKO.1 2792 3UTR 100% 4.050 3.240 N Tcf12 n/a
6 TRCN0000235849 GAAGGCCTTGGCATCTATTTA pLKO_005 1252 CDS 100% 15.000 10.500 N Tcf12 n/a
7 TRCN0000235846 GACCATAGCCTAGCTAATATT pLKO_005 3116 3UTR 100% 15.000 10.500 N Tcf12 n/a
8 TRCN0000235847 ATGTCTCAGTCCAGTAGTTAT pLKO_005 1010 CDS 100% 13.200 9.240 N Tcf12 n/a
9 TRCN0000075505 GCCGAATGTGTCAGCTTCATT pLKO.1 2106 CDS 100% 5.625 3.938 N Tcf12 n/a
10 TRCN0000075507 CCCACAGTTCTTCTGACCTTT pLKO.1 924 CDS 100% 4.950 3.465 N Tcf12 n/a
11 TRCN0000075506 CCTTCATCAGATGACATGAAA pLKO.1 1901 CDS 100% 0.563 0.394 N Tcf12 n/a
12 TRCN0000274220 TACCAACCCTATGGGTCATAT pLKO_005 2329 CDS 100% 0.000 0.000 N TCF12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07037 pDONR223 100% 91.5% 95.6% None (many diffs) n/a
2 ccsbBroad304_07037 pLX_304 0% 91.5% 95.6% V5 (many diffs) n/a
Download CSV