Transcript: Mouse XM_006511157.1

PREDICTED: Mus musculus SH2 domain containing 7 (Sh2d7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sh2d7 (244885)
Length:
3061
CDS:
7..1383

Additional Resources:

NCBI RefSeq record:
XM_006511157.1
NBCI Gene record:
Sh2d7 (244885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247534 ACTATGGCTATGAGAAGATTT pLKO_005 1226 CDS 100% 13.200 9.240 N Sh2d7 n/a
2 TRCN0000247535 AGGCTCTACAATGCCTTATAC pLKO_005 918 CDS 100% 13.200 9.240 N Sh2d7 n/a
3 TRCN0000247536 TTGTGCTGCAGACACCTATTT pLKO_005 2017 3UTR 100% 13.200 9.240 N Sh2d7 n/a
4 TRCN0000247537 TCCCACATACAGCCAACAATC pLKO_005 1194 CDS 100% 10.800 7.560 N Sh2d7 n/a
5 TRCN0000247538 TGAAGCAAGCTCTACAGATAC pLKO_005 1044 CDS 100% 10.800 7.560 N Sh2d7 n/a
6 TRCN0000189789 GCACAAGAAAGCCCTAGACAT pLKO.1 588 CDS 100% 4.950 3.465 N Sh2d7 n/a
7 TRCN0000190233 CTAAGGAAGATAAACCGGGCA pLKO.1 736 CDS 100% 0.540 0.378 N Sh2d7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.